Incidental Mutation 'R2167:Ccne2'
ID235531
Institutional Source Beutler Lab
Gene Symbol Ccne2
Ensembl Gene ENSMUSG00000028212
Gene Namecyclin E2
Synonyms
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11191351-11204779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11197249 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 183 (M183L)
Ref Sequence ENSEMBL: ENSMUSP00000029866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029866] [ENSMUST00000044616] [ENSMUST00000108324] [ENSMUST00000170901]
Predicted Effect probably benign
Transcript: ENSMUST00000029866
AA Change: M183L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029866
Gene: ENSMUSG00000028212
AA Change: M183L

DomainStartEndE-ValueType
CYCLIN 146 231 2.16e-24 SMART
Cyclin_C 240 362 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044616
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108324
AA Change: M184L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103960
Gene: ENSMUSG00000028212
AA Change: M184L

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149075
Predicted Effect probably benign
Transcript: ENSMUST00000170901
AA Change: M184L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130693
Gene: ENSMUSG00000028212
AA Change: M184L

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for disruptions in this gene are phenotypically normal. Male mice show reduced fertility but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Ccne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Ccne2 APN 4 11199322 missense probably benign 0.01
IGL02207:Ccne2 APN 4 11202261 missense probably benign 0.00
IGL02885:Ccne2 APN 4 11198723 splice site probably benign
R0367:Ccne2 UTSW 4 11201426 splice site probably benign
R0686:Ccne2 UTSW 4 11197220 missense possibly damaging 0.93
R1056:Ccne2 UTSW 4 11192707 missense probably damaging 0.99
R1068:Ccne2 UTSW 4 11192850 missense probably benign
R2076:Ccne2 UTSW 4 11197177 missense probably damaging 1.00
R2190:Ccne2 UTSW 4 11197241 missense probably benign 0.02
R3724:Ccne2 UTSW 4 11203039 missense probably benign 0.09
R3766:Ccne2 UTSW 4 11199293 splice site probably benign
R4595:Ccne2 UTSW 4 11202986 missense probably benign
R5469:Ccne2 UTSW 4 11201353 nonsense probably null
R5543:Ccne2 UTSW 4 11194026 missense probably benign 0.04
R5884:Ccne2 UTSW 4 11199411 missense probably benign 0.00
R6298:Ccne2 UTSW 4 11199306 missense probably damaging 1.00
R7493:Ccne2 UTSW 4 11198772 missense probably damaging 1.00
R7553:Ccne2 UTSW 4 11201348 missense probably benign 0.02
R7591:Ccne2 UTSW 4 11201393 missense probably benign
R7801:Ccne2 UTSW 4 11194079 critical splice donor site probably null
R7996:Ccne2 UTSW 4 11201347 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTCAAAGTAGCTTGTAATTTGG -3'
(R):5'- AGACCATTCTTGTGAACTCAGGTG -3'

Sequencing Primer
(F):5'- ACACTCTTCATAGGGAGAC -3'
(R):5'- ATGTAACAACACTGACCTATGATAAC -3'
Posted On2014-10-01