Incidental Mutation 'R2167:Olfr1341'
List |< first << previous [record 32 of 56] next >> last >|
ID235534
Institutional Source Beutler Lab
Gene Symbol Olfr1341
Ensembl Gene ENSMUSG00000046790
Gene Nameolfactory receptor 1341
SynonymsMOR258-1, GA_x6K02T2QD9B-18838170-18837232
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118703523-118713438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118710055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 216 (V216A)
Ref Sequence ENSEMBL: ENSMUSP00000149466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061215] [ENSMUST00000214131] [ENSMUST00000215117]
Predicted Effect probably benign
Transcript: ENSMUST00000061215
AA Change: V216A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095523
Gene: ENSMUSG00000046790
AA Change: V216A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-7 PFAM
Pfam:7tm_1 41 290 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214131
AA Change: V216A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215117
AA Change: V216A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Olfr1341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Olfr1341 APN 4 118709922 missense probably damaging 1.00
IGL02699:Olfr1341 APN 4 118710198 missense probably benign 0.36
IGL02798:Olfr1341 APN 4 118709499 missense probably damaging 0.97
IGL03271:Olfr1341 APN 4 118709785 missense probably damaging 0.99
R0085:Olfr1341 UTSW 4 118709881 missense probably benign 0.18
R0355:Olfr1341 UTSW 4 118709611 missense probably benign 0.06
R1134:Olfr1341 UTSW 4 118710279 missense probably damaging 0.97
R1561:Olfr1341 UTSW 4 118709554 missense probably damaging 0.99
R1574:Olfr1341 UTSW 4 118709554 missense probably damaging 0.99
R2182:Olfr1341 UTSW 4 118710345 makesense probably null
R2237:Olfr1341 UTSW 4 118709995 missense probably damaging 1.00
R3775:Olfr1341 UTSW 4 118710154 missense probably damaging 1.00
R6000:Olfr1341 UTSW 4 118710244 missense probably damaging 1.00
R6249:Olfr1341 UTSW 4 118709713 missense probably damaging 1.00
R6331:Olfr1341 UTSW 4 118709947 missense probably benign 0.34
R6527:Olfr1341 UTSW 4 118709848 missense possibly damaging 0.56
R7795:Olfr1341 UTSW 4 118709658 missense possibly damaging 0.94
X0063:Olfr1341 UTSW 4 118709755 missense probably damaging 1.00
Z1088:Olfr1341 UTSW 4 118710226 missense probably benign 0.00
Z1177:Olfr1341 UTSW 4 118710158 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATACCATCTTTGCCATGCGC -3'
(R):5'- TTCCGGAGACTATAGATGACAGG -3'

Sequencing Primer
(F):5'- ATGCGCCTCCCCTACTGTG -3'
(R):5'- AGAATAGGGCAAGCTTCTTGTC -3'
Posted On2014-10-01