Incidental Mutation 'R2167:Rassf6'
ID 235537
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
MMRRC Submission 040170-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R2167 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90751797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 308 (E308K)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031317
AA Change: E321K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: E321K

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202704
AA Change: E321K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: E321K

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202784
AA Change: E308K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: E308K

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Meta Mutation Damage Score 0.2421 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,238,532 (GRCm39) T710M probably benign Het
Acan A G 7: 78,749,705 (GRCm39) E1492G probably benign Het
Acsl1 A G 8: 46,986,627 (GRCm39) D638G possibly damaging Het
Acsl6 C A 11: 54,217,983 (GRCm39) T207K probably benign Het
Ahnak A T 19: 8,988,858 (GRCm39) K3381* probably null Het
Art1 T C 7: 101,756,031 (GRCm39) V74A probably damaging Het
Bhmt2 A T 13: 93,799,012 (GRCm39) W270R probably benign Het
Calm2 T C 17: 87,742,573 (GRCm39) T118A probably benign Het
Ccdc88b G T 19: 6,831,452 (GRCm39) Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 (GRCm39) M183L probably benign Het
Cdc42bpg A G 19: 6,367,707 (GRCm39) I1026V probably damaging Het
Celsr2 T C 3: 108,320,509 (GRCm39) T768A probably damaging Het
Cog5 T C 12: 31,887,288 (GRCm39) F470L probably damaging Het
Cpne5 T C 17: 29,381,306 (GRCm39) D374G probably damaging Het
Disp2 A C 2: 118,622,166 (GRCm39) E966A probably damaging Het
Dmrtc2 C T 7: 24,573,344 (GRCm39) probably benign Het
Eif2b3 T A 4: 116,885,737 (GRCm39) I93N probably damaging Het
Elfn2 C A 15: 78,556,646 (GRCm39) V634L probably benign Het
Fasl T G 1: 161,614,707 (GRCm39) S119R probably benign Het
Foxp2 C G 6: 15,437,901 (GRCm39) P701A probably damaging Het
Helz T A 11: 107,563,790 (GRCm39) probably benign Het
Kctd6 T C 14: 8,222,683 (GRCm38) V175A probably benign Het
Leo1 A G 9: 75,352,991 (GRCm39) N178S probably benign Het
Lhx6 C A 2: 35,993,371 (GRCm39) R80L probably damaging Het
Man1a2 A G 3: 100,499,216 (GRCm39) L406P probably damaging Het
Mapkap1 T C 2: 34,487,494 (GRCm39) F231L probably damaging Het
Mknk2 A G 10: 80,504,535 (GRCm39) Y256H probably damaging Het
Msh6 A G 17: 88,296,911 (GRCm39) T1203A probably damaging Het
Nbeal2 T C 9: 110,467,376 (GRCm39) Y604C probably damaging Het
Ncam1 G T 9: 49,479,781 (GRCm39) Q66K probably benign Het
Nsd2 T A 5: 34,040,263 (GRCm39) H933Q probably damaging Het
Or10h5 T A 17: 33,434,542 (GRCm39) I262F probably damaging Het
Or13p3 T C 4: 118,567,252 (GRCm39) V216A probably benign Het
Or2d3c A G 7: 106,525,797 (GRCm39) Y290H probably damaging Het
Or5h23 T A 16: 58,905,949 (GRCm39) K299I probably benign Het
Pappa A C 4: 65,074,682 (GRCm39) D412A probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rb1 T C 14: 73,449,091 (GRCm39) T680A probably damaging Het
Rfpl4 T A 7: 5,113,852 (GRCm39) I104F probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rnase6 A C 14: 51,367,974 (GRCm39) D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,229,113 (GRCm39) probably benign Het
Sec31b G A 19: 44,531,792 (GRCm39) T39I possibly damaging Het
Slc12a1 A G 2: 125,015,601 (GRCm39) I385V probably damaging Het
Slc6a17 A T 3: 107,398,817 (GRCm39) Y261* probably null Het
Supt6 G A 11: 78,098,993 (GRCm39) P1626L possibly damaging Het
Tbx15 A G 3: 99,233,771 (GRCm39) probably benign Het
Telo2 A G 17: 25,329,792 (GRCm39) V240A probably benign Het
Trhr C T 15: 44,092,638 (GRCm39) L292F probably damaging Het
Trps1 G A 15: 50,695,126 (GRCm39) L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 (GRCm38) probably benign Het
Yeats2 T C 16: 20,032,151 (GRCm39) probably benign Het
Zbtb39 G A 10: 127,578,844 (GRCm39) E473K probably benign Het
Zfp235 T A 7: 23,840,387 (GRCm39) S269T possibly damaging Het
Zfp580 C A 7: 5,056,063 (GRCm39) P141Q possibly damaging Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTCGTTCGTCCAAAGC -3'
(R):5'- AGGGTGCTTCTTAACCTAAAACC -3'

Sequencing Primer
(F):5'- GCTTCAGAGCCATGCATATTAGG -3'
(R):5'- AGGTGGCTCCGTACATTAATTTTCAC -3'
Posted On 2014-10-01