Incidental Mutation 'R2167:Rassf6'
List |< first << previous [record 38 of 56] next >> last >|
ID235537
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Synonyms1600016B17Rik
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90603938 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 308 (E308K)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect probably damaging
Transcript: ENSMUST00000031317
AA Change: E321K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: E321K

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202704
AA Change: E321K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: E321K

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202784
AA Change: E308K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: E308K

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Meta Mutation Damage Score 0.2421 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTCGTTCGTCCAAAGC -3'
(R):5'- AGGGTGCTTCTTAACCTAAAACC -3'

Sequencing Primer
(F):5'- GCTTCAGAGCCATGCATATTAGG -3'
(R):5'- AGGTGGCTCCGTACATTAATTTTCAC -3'
Posted On2014-10-01