Incidental Mutation 'R2167:Art1'
ID235548
Institutional Source Beutler Lab
Gene Symbol Art1
Ensembl Gene ENSMUSG00000030996
Gene NameADP-ribosyltransferase 1
SynonymsADPRT, Yac-1
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2167 (G1)
Quality Score218
Status Validated
Chromosome7
Chromosomal Location102101743-102113933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102106824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000147911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084830] [ENSMUST00000094128] [ENSMUST00000209809] [ENSMUST00000210211]
Predicted Effect probably damaging
Transcript: ENSMUST00000033300
AA Change: V74A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996
AA Change: V74A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084830
SMART Domains Protein: ENSMUSP00000081891
Gene: ENSMUSG00000066279

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 30 236 1.5e-67 PFAM
Pfam:Neur_chan_memb 243 384 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209809
AA Change: V74A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Meta Mutation Damage Score 0.2623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Art1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Art1 APN 7 102110748 missense probably damaging 0.97
IGL03238:Art1 APN 7 102110749 missense possibly damaging 0.46
R0885:Art1 UTSW 7 102107334 missense probably damaging 1.00
R1343:Art1 UTSW 7 102106953 missense probably damaging 1.00
R1348:Art1 UTSW 7 102107372 missense possibly damaging 0.55
R4637:Art1 UTSW 7 102106337 missense probably damaging 0.96
R4821:Art1 UTSW 7 102107178 missense probably damaging 1.00
R5629:Art1 UTSW 7 102107079 missense probably benign 0.07
R6150:Art1 UTSW 7 102107087 missense probably benign
R6936:Art1 UTSW 7 102106770 missense possibly damaging 0.58
R7304:Art1 UTSW 7 102106324 missense possibly damaging 0.56
R8039:Art1 UTSW 7 102106845 missense probably benign 0.00
R8100:Art1 UTSW 7 102107198 missense probably damaging 1.00
R8183:Art1 UTSW 7 102107426 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTCCAGATGTATTTGGGG -3'
(R):5'- CTGCGTTGAACTCCTTGTGC -3'

Sequencing Primer
(F):5'- AGATGAGCGGGCCCTCATTTTC -3'
(R):5'- CTCCTTGTGCAGGGGGCTG -3'
Posted On2014-10-01