Incidental Mutation 'R2167:Acsl1'
List |< first << previous [record 3 of 56] next >> last >|
ID235552
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46533590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 638 (D638G)
Ref Sequence ENSEMBL: ENSMUSP00000106001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034046
AA Change: D638G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796
AA Change: D638G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110371
AA Change: D638G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796
AA Change: D638G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110372
AA Change: D638G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796
AA Change: D638G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133161
Predicted Effect unknown
Transcript: ENSMUST00000152423
AA Change: T93A
SMART Domains Protein: ENSMUSP00000118845
Gene: ENSMUSG00000018796
AA Change: T93A

DomainStartEndE-ValueType
SCOP:d1lci__ 2 65 2e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210929
Meta Mutation Damage Score 0.8612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 splice site probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R3051:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3052:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R3956:Acsl1 UTSW 8 46534458 missense probably damaging 1.00
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5012:Acsl1 UTSW 8 46521431 missense probably benign 0.01
R5168:Acsl1 UTSW 8 46513266 unclassified probably benign
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7151:Acsl1 UTSW 8 46513597 missense probably damaging 1.00
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGAGGCTTACAAGGGTCC -3'
(R):5'- TAGGTCCACTCTTCAACCTCTAAAATC -3'

Sequencing Primer
(F):5'- GCTTACAAGGGTCCTTCGAAG -3'
(R):5'- CATCTATAATGGGATCTGATGCCC -3'
Posted On2014-10-01