Incidental Mutation 'R2167:Cog5'
List |< first << previous [record 13 of 56] next >> last >|
ID235563
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Namecomponent of oligomeric golgi complex 5
Synonyms5430405C01Rik, GOLTC1, GTC90
MMRRC Submission 040170-MU
Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31654869-31937630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31837289 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 470 (F470L)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862]
Predicted Effect probably damaging
Transcript: ENSMUST00000036862
AA Change: F470L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: F470L

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Meta Mutation Damage Score 0.5465 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31685704 missense probably damaging 1.00
IGL00495:Cog5 APN 12 31837309 missense probably benign 0.06
IGL00763:Cog5 APN 12 31665532 splice site probably benign
IGL00789:Cog5 APN 12 31760952 missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31886206 missense probably benign 0.13
IGL01315:Cog5 APN 12 31760986 splice site probably benign
IGL01396:Cog5 APN 12 31894096 missense probably benign 0.01
IGL02468:Cog5 APN 12 31837358 critical splice donor site probably null
IGL03030:Cog5 APN 12 31790922 missense probably damaging 0.99
IGL03346:Cog5 APN 12 31894038 missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31839841 missense probably damaging 0.99
R0356:Cog5 UTSW 12 31837181 splice site probably benign
R0492:Cog5 UTSW 12 31869461 missense probably damaging 1.00
R0646:Cog5 UTSW 12 31837359 splice site probably benign
R0971:Cog5 UTSW 12 31919678 missense probably benign 0.11
R1158:Cog5 UTSW 12 31870057 splice site probably benign
R1997:Cog5 UTSW 12 31660849 missense possibly damaging 0.66
R4414:Cog5 UTSW 12 31660854 nonsense probably null
R4755:Cog5 UTSW 12 31869406 splice site probably null
R4836:Cog5 UTSW 12 31919733 missense probably benign 0.07
R5017:Cog5 UTSW 12 31920605 missense probably benign 0.29
R5256:Cog5 UTSW 12 31886205 missense probably benign
R5986:Cog5 UTSW 12 31660717 missense probably benign 0.03
R6131:Cog5 UTSW 12 31886221 missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31894199 missense probably damaging 1.00
R7056:Cog5 UTSW 12 31665469 missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R7182:Cog5 UTSW 12 31685708 missense probably damaging 1.00
R7418:Cog5 UTSW 12 31833241 missense probably damaging 1.00
R7445:Cog5 UTSW 12 31919672 missense possibly damaging 0.64
R7585:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R8332:Cog5 UTSW 12 31833223 nonsense probably null
X0062:Cog5 UTSW 12 31685692 missense probably benign 0.01
Z1177:Cog5 UTSW 12 31801985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGGTGTTCAGTTATGAAGCATGC -3'
(R):5'- ATTGAACCCTAATCACTAGACTGG -3'

Sequencing Primer
(F):5'- TGAAGCATGCTTGTAAATGTGC -3'
(R):5'- CCCTAATCACTAGACTGGTTTGAGG -3'
Posted On2014-10-01