Incidental Mutation 'R2167:Bhmt2'
List |< first << previous [record 7 of 56] next >> last >|
ID235565
Institutional Source Beutler Lab
Gene Symbol Bhmt2
Ensembl Gene ENSMUSG00000042118
Gene Namebetaine-homocysteine methyltransferase 2
SynonymsC81077, D13Ucla2
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93655720-93674302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93662504 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 270 (W270R)
Ref Sequence ENSEMBL: ENSMUSP00000015941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015941]
Predicted Effect probably benign
Transcript: ENSMUST00000015941
AA Change: W270R

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000015941
Gene: ENSMUSG00000042118
AA Change: W270R

DomainStartEndE-ValueType
Pfam:S-methyl_trans 23 305 3.9e-44 PFAM
Meta Mutation Damage Score 0.5300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Bhmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Bhmt2 APN 13 93666771 splice site probably benign
IGL01665:Bhmt2 APN 13 93663153 nonsense probably null
IGL02059:Bhmt2 APN 13 93666663 missense probably benign
IGL02239:Bhmt2 APN 13 93663179 missense probably benign 0.00
IGL02267:Bhmt2 APN 13 93669346 missense probably damaging 1.00
IGL03148:Bhmt2 APN 13 93666653 missense possibly damaging 0.48
R1171:Bhmt2 UTSW 13 93662329 missense probably benign 0.00
R1517:Bhmt2 UTSW 13 93662339 missense probably damaging 0.97
R1886:Bhmt2 UTSW 13 93662490 missense probably benign 0.02
R4024:Bhmt2 UTSW 13 93663331 splice site probably benign
R4823:Bhmt2 UTSW 13 93663290 missense probably benign
R5273:Bhmt2 UTSW 13 93666578 missense possibly damaging 0.84
R5333:Bhmt2 UTSW 13 93671430 missense probably benign 0.00
R5738:Bhmt2 UTSW 13 93663290 missense probably benign
R5955:Bhmt2 UTSW 13 93663197 missense probably benign 0.00
R6281:Bhmt2 UTSW 13 93663160 missense probably damaging 1.00
R6858:Bhmt2 UTSW 13 93671440 missense probably damaging 0.97
R6934:Bhmt2 UTSW 13 93662311 missense probably benign 0.18
R6985:Bhmt2 UTSW 13 93663322 missense possibly damaging 0.64
R7185:Bhmt2 UTSW 13 93663271 missense probably benign 0.22
R7639:Bhmt2 UTSW 13 93663314 missense probably damaging 1.00
R8412:Bhmt2 UTSW 13 93662312 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGTTCAGACCACTTCCCCAG -3'
(R):5'- TGTTTAAAAGATGGAGCTGCG -3'

Sequencing Primer
(F):5'- AGCTGCCATGTTTCTCTGAAG -3'
(R):5'- AGTGTTAGATCGCTGGTCACATCAC -3'
Posted On2014-10-01