Incidental Mutation 'R2167:Rnase6'
ID235568
Institutional Source Beutler Lab
Gene Symbol Rnase6
Ensembl Gene ENSMUSG00000021880
Gene Nameribonuclease, RNase A family, 6
Synonyms
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51123908-51132187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 51130517 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 122 (D122A)
Ref Sequence ENSEMBL: ENSMUSP00000154125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095923] [ENSMUST00000226194] [ENSMUST00000226210]
Predicted Effect probably benign
Transcript: ENSMUST00000095923
AA Change: D122A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093613
Gene: ENSMUSG00000021880
AA Change: D122A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
RNAse_Pc 30 153 4.83e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226194
AA Change: D122A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228752
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ribonuclease A superfamily and functions in the urinary tract. The protein has broad-spectrum antimicrobial activity against pathogenic bacteria. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Rnase6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Rnase6 APN 14 51130291 missense probably benign 0.08
IGL02592:Rnase6 APN 14 51130525 missense probably benign 0.02
R1960:Rnase6 UTSW 14 51130432 missense possibly damaging 0.95
R5197:Rnase6 UTSW 14 51130213 missense unknown
R8364:Rnase6 UTSW 14 51130453 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CGCGGTGTCAACAATTATACCC -3'
(R):5'- TCCGTTTTGATAGCGTAGGC -3'

Sequencing Primer
(F):5'- GGTGTCAACAATTATACCCAACACTG -3'
(R):5'- GATAGCGTAGGCATCTTAATTCTTCC -3'
Posted On2014-10-01