Incidental Mutation 'R2167:Telo2'
ID235575
Institutional Source Beutler Lab
Gene Symbol Telo2
Ensembl Gene ENSMUSG00000024170
Gene Nametelomere maintenance 2
Synonyms1200003M09Rik
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2167 (G1)
Quality Score118
Status Validated
Chromosome17
Chromosomal Location25099570-25115967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25110818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 240 (V240A)
Ref Sequence ENSEMBL: ENSMUSP00000110835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024987] [ENSMUST00000115181]
Predicted Effect probably benign
Transcript: ENSMUST00000024987
AA Change: V240A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170
AA Change: V240A

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115181
AA Change: V240A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170
AA Change: V240A

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156698
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as an S-phase checkpoint protein in the cell cycle. The protein may also play a role in DNA repair.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccdc88b G T 19: 6,854,084 Q497K possibly damaging Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Telo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Telo2 APN 17 25100129 splice site probably benign
IGL01398:Telo2 APN 17 25105774 missense probably benign 0.00
IGL01878:Telo2 APN 17 25101358 missense probably benign 0.19
IGL02728:Telo2 APN 17 25104654 missense probably damaging 1.00
R0669:Telo2 UTSW 17 25105823 missense probably benign 0.01
R0671:Telo2 UTSW 17 25113165 missense probably benign 0.00
R1783:Telo2 UTSW 17 25102738 splice site probably null
R1869:Telo2 UTSW 17 25114994 missense probably benign 0.32
R1988:Telo2 UTSW 17 25101668 missense probably benign 0.04
R2018:Telo2 UTSW 17 25105408 missense probably damaging 1.00
R2219:Telo2 UTSW 17 25103699 missense probably benign 0.00
R3421:Telo2 UTSW 17 25110752 missense probably damaging 0.99
R3880:Telo2 UTSW 17 25106833 missense probably damaging 1.00
R4190:Telo2 UTSW 17 25102013 missense probably benign 0.00
R4299:Telo2 UTSW 17 25115256 missense possibly damaging 0.94
R4574:Telo2 UTSW 17 25101673 missense probably damaging 1.00
R4600:Telo2 UTSW 17 25105148 missense possibly damaging 0.79
R6010:Telo2 UTSW 17 25104878 missense possibly damaging 0.79
R6185:Telo2 UTSW 17 25102040 missense probably benign 0.29
R6513:Telo2 UTSW 17 25101412 missense probably damaging 1.00
R7352:Telo2 UTSW 17 25102069 missense probably damaging 1.00
R7538:Telo2 UTSW 17 25110821 missense probably benign 0.08
R8347:Telo2 UTSW 17 25104637 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAACAGCCAGCCTGGAAAG -3'
(R):5'- AGTGGGATCGCCTCATTTGG -3'

Sequencing Primer
(F):5'- ATGGGCTCTAATGCGGCAC -3'
(R):5'- ATCGCCTCATTTGGGTCGGAC -3'
Posted On2014-10-01