Incidental Mutation 'R2167:Ccdc88b'
List |< first << previous [record 9 of 56] next >> last >|
ID235581
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Namecoiled-coil domain containing 88B
Synonyms
MMRRC Submission 040170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2167 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6844623-6858211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6854084 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 497 (Q497K)
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113440
AA Change: Q497K

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: Q497K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,288,532 T710M probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Acsl1 A G 8: 46,533,590 D638G possibly damaging Het
Acsl6 C A 11: 54,327,157 T207K probably benign Het
Ahnak A T 19: 9,011,494 K3381* probably null Het
Art1 T C 7: 102,106,824 V74A probably damaging Het
Bhmt2 A T 13: 93,662,504 W270R probably benign Het
Calm2 T C 17: 87,435,145 T118A probably benign Het
Ccne2 A T 4: 11,197,249 M183L probably benign Het
Cdc42bpg A G 19: 6,317,677 I1026V probably damaging Het
Celsr2 T C 3: 108,413,193 T768A probably damaging Het
Cog5 T C 12: 31,837,289 F470L probably damaging Het
Cpne5 T C 17: 29,162,332 D374G probably damaging Het
Disp2 A C 2: 118,791,685 E966A probably damaging Het
Dmrtc2 C T 7: 24,873,919 probably benign Het
Eif2b3 T A 4: 117,028,540 I93N probably damaging Het
Elfn2 C A 15: 78,672,446 V634L probably benign Het
Fasl T G 1: 161,787,138 S119R probably benign Het
Foxp2 C G 6: 15,437,902 P701A probably damaging Het
Helz T A 11: 107,672,964 probably benign Het
Kctd6 T C 14: 8,222,683 V175A probably benign Het
Leo1 A G 9: 75,445,709 N178S probably benign Het
Lhx6 C A 2: 36,103,359 R80L probably damaging Het
Man1a2 A G 3: 100,591,900 L406P probably damaging Het
Mapkap1 T C 2: 34,597,482 F231L probably damaging Het
Mknk2 A G 10: 80,668,701 Y256H probably damaging Het
Msh6 A G 17: 87,989,483 T1203A probably damaging Het
Nbeal2 T C 9: 110,638,308 Y604C probably damaging Het
Ncam1 G T 9: 49,568,481 Q66K probably benign Het
Nsd2 T A 5: 33,882,919 H933Q probably damaging Het
Olfr1341 T C 4: 118,710,055 V216A probably benign Het
Olfr1564 T A 17: 33,215,568 I262F probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr709-ps1 A G 7: 106,926,590 Y290H probably damaging Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rassf6 C T 5: 90,603,938 E308K probably damaging Het
Rb1 T C 14: 73,211,651 T680A probably damaging Het
Rfpl4 T A 7: 5,110,853 I104F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnase6 A C 14: 51,130,517 D122A probably benign Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sec31b G A 19: 44,543,353 T39I possibly damaging Het
Slc12a1 A G 2: 125,173,681 I385V probably damaging Het
Slc6a17 A T 3: 107,491,501 Y261* probably null Het
Supt6 G A 11: 78,208,167 P1626L possibly damaging Het
Tbx15 A G 3: 99,326,455 probably benign Het
Telo2 A G 17: 25,110,818 V240A probably benign Het
Trhr C T 15: 44,229,242 L292F probably damaging Het
Trps1 G A 15: 50,831,730 L340F possibly damaging Het
Ube2e1 T C 14: 18,284,429 probably benign Het
Yeats2 T C 16: 20,213,401 probably benign Het
Zbtb39 G A 10: 127,742,975 E473K probably benign Het
Zfp235 T A 7: 24,140,962 S269T possibly damaging Het
Zfp580 C A 7: 5,053,064 P141Q possibly damaging Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6845086 missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6846710 missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6846631 missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6855349 splice site probably benign
IGL02276:Ccdc88b APN 19 6856107 critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6846644 missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6856949 missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6847409 missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6853783 missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6857266 missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6854214 missense probably benign
R0920:Ccdc88b UTSW 19 6846649 missense probably benign
R0975:Ccdc88b UTSW 19 6846625 missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6853213 missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6850371 missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6854023 missense probably benign
R1605:Ccdc88b UTSW 19 6850469 missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6853322 missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6853532 nonsense probably null
R1839:Ccdc88b UTSW 19 6854109 splice site probably benign
R1917:Ccdc88b UTSW 19 6849226 missense probably damaging 1.00
R4012:Ccdc88b UTSW 19 6848991 missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6850272 missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6850572 missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6853000 missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6848268 missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6857715 missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6857113 missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6856141 missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6848232 missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6857740 missense unknown
R5448:Ccdc88b UTSW 19 6854580 missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6853835 missense probably benign
R5783:Ccdc88b UTSW 19 6853916 missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6855980 missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6849038 missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6854878 missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6849041 missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6853962 missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6857469 missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6849086 missense probably benign
R8298:Ccdc88b UTSW 19 6850281 missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6847322 missense probably damaging 0.99
X0021:Ccdc88b UTSW 19 6853831 missense probably benign
Z1176:Ccdc88b UTSW 19 6849740 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTGAGAACACTTGGGTGAC -3'
(R):5'- CACCCTCACTGCAAGATGAG -3'

Sequencing Primer
(F):5'- ACCTTGTGATGTCAGAGTATGATGC -3'
(R):5'- CCCTCACTGCAAGATGAGGTGAG -3'
Posted On2014-10-01