Incidental Mutation 'R2168:Olfr1209'
ID235591
Institutional Source Beutler Lab
Gene Symbol Olfr1209
Ensembl Gene ENSMUSG00000075113
Gene Nameolfactory receptor 1209
SynonymsMOR230-7, GA_x6K02T2Q125-50386882-50385950
MMRRC Submission 040171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2168 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88904942-88915157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88910178 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 72 (S72P)
Ref Sequence ENSEMBL: ENSMUSP00000150607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099809] [ENSMUST00000213136]
Predicted Effect probably damaging
Transcript: ENSMUST00000099809
AA Change: S72P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097397
Gene: ENSMUSG00000075113
AA Change: S72P

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.3e-5 PFAM
Pfam:7tm_1 39 285 7.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213136
AA Change: S72P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213240
Meta Mutation Damage Score 0.2854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,878,781 I188N probably damaging Het
Akr1c14 T C 13: 4,081,106 V266A probably damaging Het
Als2cl C A 9: 110,888,742 P301H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cpsf1 A T 15: 76,603,737 N53K possibly damaging Het
Ctsll3 C T 13: 60,800,935 G69R possibly damaging Het
F2 C T 2: 91,628,348 R539Q probably damaging Het
Fam78b G A 1: 167,078,650 G126D probably damaging Het
Fancd2 A G 6: 113,591,159 I1332V possibly damaging Het
Flg2 C T 3: 93,201,937 S424L probably damaging Het
Fpr1 T C 17: 17,877,209 T173A possibly damaging Het
Gas2l3 A G 10: 89,414,098 V386A probably benign Het
Gdap2 A C 3: 100,187,883 E269A probably benign Het
Gm16432 C T 1: 178,015,911 probably benign Het
Igf2bp2 T A 16: 22,079,608 probably null Het
Ipo11 T C 13: 106,879,610 probably null Het
Itpr2 G T 6: 146,111,678 P2667Q probably benign Het
Itsn2 G T 12: 4,633,044 probably benign Het
Jakmip2 A G 18: 43,565,930 L488P probably damaging Het
Lrp1b A T 2: 41,375,846 C248S probably damaging Het
Lrrc17 A T 5: 21,575,048 D340V probably damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mrc1 T C 2: 14,244,204 S184P possibly damaging Het
Msh4 A T 3: 153,867,835 Y533* probably null Het
Mug1 A G 6: 121,870,499 N612S probably benign Het
Nectin2 G T 7: 19,730,614 S288R probably damaging Het
Neurog2 A T 3: 127,634,105 H126L probably damaging Het
Nol10 A T 12: 17,373,584 E310V probably damaging Het
Olfr1366 T G 13: 21,537,252 K251T probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr573-ps1 A T 7: 102,942,471 F35L probably benign Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Pcdhb7 T A 18: 37,343,282 F490L probably benign Het
Pcsk1 T A 13: 75,112,534 probably benign Het
Plekhn1 T A 4: 156,221,882 D577V probably damaging Het
Prrc2c C A 1: 162,710,334 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pzp G A 6: 128,488,047 T1288M probably damaging Het
Radil A C 5: 142,506,963 H63Q probably benign Het
Rai1 T C 11: 60,187,596 S829P probably benign Het
Rd3 A G 1: 191,983,527 I88V probably damaging Het
Rfesd T C 13: 76,008,125 D54G probably damaging Het
Rnf213 A C 11: 119,415,070 K568T probably damaging Het
Scaper T A 9: 55,743,639 K913N probably damaging Het
Serpina3c T C 12: 104,149,369 probably null Het
Serpinb6d A T 13: 33,666,374 K61N probably benign Het
Skint4 A T 4: 112,086,986 probably null Het
Sod1 T C 16: 90,220,913 I19T possibly damaging Het
Stfa3 C A 16: 36,450,680 G81* probably null Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Uggt2 T A 14: 119,019,505 N1106Y probably damaging Het
Vmn1r217 G A 13: 23,114,544 Q63* probably null Het
Vmn2r-ps159 A T 4: 156,338,378 noncoding transcript Het
Vps13b C A 15: 35,792,188 P2201T probably damaging Het
Vps13b C A 15: 35,792,189 P2201Q probably damaging Het
Vps13d G T 4: 145,087,323 probably benign Het
Zer1 A G 2: 30,104,875 C503R probably damaging Het
Zfp369 T C 13: 65,296,948 V635A probably benign Het
Zfp608 A T 18: 54,898,053 Y938* probably null Het
Other mutations in Olfr1209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03103:Olfr1209 APN 2 88910178 missense probably benign 0.18
R0179:Olfr1209 UTSW 2 88909893 missense possibly damaging 0.62
R0245:Olfr1209 UTSW 2 88909875 missense possibly damaging 0.72
R0737:Olfr1209 UTSW 2 88910273 missense probably damaging 1.00
R2311:Olfr1209 UTSW 2 88909469 missense probably benign 0.00
R3429:Olfr1209 UTSW 2 88909466 missense probably benign
R3430:Olfr1209 UTSW 2 88909466 missense probably benign
R3876:Olfr1209 UTSW 2 88909608 missense possibly damaging 0.96
R5717:Olfr1209 UTSW 2 88910022 missense possibly damaging 0.57
R6029:Olfr1209 UTSW 2 88910036 missense probably damaging 1.00
R6154:Olfr1209 UTSW 2 88910390 start codon destroyed probably null 1.00
R7188:Olfr1209 UTSW 2 88909859 missense probably damaging 1.00
R7197:Olfr1209 UTSW 2 88910364 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGCAGGGGCTTACAGATG -3'
(R):5'- TCACTAATGAGAAACAATGTGGCTG -3'

Sequencing Primer
(F):5'- TTACAGATGGCCACATATCGGTC -3'
(R):5'- TGTGGCTGAATAACAATGTGACTG -3'
Posted On2014-10-01