Incidental Mutation 'R2168:Acoxl'
ID235594
Institutional Source Beutler Lab
Gene Symbol Acoxl
Ensembl Gene ENSMUSG00000027380
Gene Nameacyl-Coenzyme A oxidase-like
Synonyms1200014P05Rik
MMRRC Submission 040171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2168 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127838876-128123873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127878781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 188 (I188N)
Ref Sequence ENSEMBL: ENSMUSP00000028859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028859]
Predicted Effect probably damaging
Transcript: ENSMUST00000028859
AA Change: I188N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028859
Gene: ENSMUSG00000027380
AA Change: I188N

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 115 223 7.2e-19 PFAM
Pfam:Acyl-CoA_dh_1 254 416 1.8e-14 PFAM
Pfam:ACOX 458 599 6.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126410
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c14 T C 13: 4,081,106 V266A probably damaging Het
Als2cl C A 9: 110,888,742 P301H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cpsf1 A T 15: 76,603,737 N53K possibly damaging Het
Ctsll3 C T 13: 60,800,935 G69R possibly damaging Het
F2 C T 2: 91,628,348 R539Q probably damaging Het
Fam78b G A 1: 167,078,650 G126D probably damaging Het
Fancd2 A G 6: 113,591,159 I1332V possibly damaging Het
Flg2 C T 3: 93,201,937 S424L probably damaging Het
Fpr1 T C 17: 17,877,209 T173A possibly damaging Het
Gas2l3 A G 10: 89,414,098 V386A probably benign Het
Gdap2 A C 3: 100,187,883 E269A probably benign Het
Gm16432 C T 1: 178,015,911 probably benign Het
Igf2bp2 T A 16: 22,079,608 probably null Het
Ipo11 T C 13: 106,879,610 probably null Het
Itpr2 G T 6: 146,111,678 P2667Q probably benign Het
Itsn2 G T 12: 4,633,044 probably benign Het
Jakmip2 A G 18: 43,565,930 L488P probably damaging Het
Lrp1b A T 2: 41,375,846 C248S probably damaging Het
Lrrc17 A T 5: 21,575,048 D340V probably damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mrc1 T C 2: 14,244,204 S184P possibly damaging Het
Msh4 A T 3: 153,867,835 Y533* probably null Het
Mug1 A G 6: 121,870,499 N612S probably benign Het
Nectin2 G T 7: 19,730,614 S288R probably damaging Het
Neurog2 A T 3: 127,634,105 H126L probably damaging Het
Nol10 A T 12: 17,373,584 E310V probably damaging Het
Olfr1209 A G 2: 88,910,178 S72P probably damaging Het
Olfr1366 T G 13: 21,537,252 K251T probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr573-ps1 A T 7: 102,942,471 F35L probably benign Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Pcdhb7 T A 18: 37,343,282 F490L probably benign Het
Pcsk1 T A 13: 75,112,534 probably benign Het
Plekhn1 T A 4: 156,221,882 D577V probably damaging Het
Prrc2c C A 1: 162,710,334 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pzp G A 6: 128,488,047 T1288M probably damaging Het
Radil A C 5: 142,506,963 H63Q probably benign Het
Rai1 T C 11: 60,187,596 S829P probably benign Het
Rd3 A G 1: 191,983,527 I88V probably damaging Het
Rfesd T C 13: 76,008,125 D54G probably damaging Het
Rnf213 A C 11: 119,415,070 K568T probably damaging Het
Scaper T A 9: 55,743,639 K913N probably damaging Het
Serpina3c T C 12: 104,149,369 probably null Het
Serpinb6d A T 13: 33,666,374 K61N probably benign Het
Skint4 A T 4: 112,086,986 probably null Het
Sod1 T C 16: 90,220,913 I19T possibly damaging Het
Stfa3 C A 16: 36,450,680 G81* probably null Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Uggt2 T A 14: 119,019,505 N1106Y probably damaging Het
Vmn1r217 G A 13: 23,114,544 Q63* probably null Het
Vmn2r-ps159 A T 4: 156,338,378 noncoding transcript Het
Vps13b C A 15: 35,792,188 P2201T probably damaging Het
Vps13b C A 15: 35,792,189 P2201Q probably damaging Het
Vps13d G T 4: 145,087,323 probably benign Het
Zer1 A G 2: 30,104,875 C503R probably damaging Het
Zfp369 T C 13: 65,296,948 V635A probably benign Het
Zfp608 A T 18: 54,898,053 Y938* probably null Het
Other mutations in Acoxl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Acoxl APN 2 127978804 missense probably damaging 1.00
IGL01397:Acoxl APN 2 128034891 missense possibly damaging 0.67
IGL02502:Acoxl APN 2 128075884 missense probably damaging 1.00
P4748:Acoxl UTSW 2 128086344 splice site probably benign
R0450:Acoxl UTSW 2 127880503 splice site probably null
R0469:Acoxl UTSW 2 127880503 splice site probably null
R0510:Acoxl UTSW 2 127880503 splice site probably null
R1257:Acoxl UTSW 2 128044366 missense probably benign 0.01
R1703:Acoxl UTSW 2 127978772 missense probably damaging 0.99
R1726:Acoxl UTSW 2 127880446 missense probably damaging 1.00
R1867:Acoxl UTSW 2 127877787 missense probably damaging 1.00
R2103:Acoxl UTSW 2 127972606 missense probably damaging 0.97
R2761:Acoxl UTSW 2 127877813 missense probably benign 0.01
R3895:Acoxl UTSW 2 127972525 splice site probably benign
R4370:Acoxl UTSW 2 127878788 missense possibly damaging 0.95
R4571:Acoxl UTSW 2 127877807 missense probably damaging 1.00
R4727:Acoxl UTSW 2 127978738 missense probably damaging 1.00
R4851:Acoxl UTSW 2 128044391 missense possibly damaging 0.62
R4962:Acoxl UTSW 2 128075890 missense probably damaging 0.98
R5248:Acoxl UTSW 2 128075935 critical splice donor site probably null
R5392:Acoxl UTSW 2 128010168 critical splice donor site probably null
R5411:Acoxl UTSW 2 127854901 missense probably benign 0.00
R5418:Acoxl UTSW 2 127877802 missense probably benign 0.34
R5507:Acoxl UTSW 2 127884474 missense probably damaging 0.99
R5681:Acoxl UTSW 2 127972639 missense possibly damaging 0.93
R5738:Acoxl UTSW 2 127877766 missense probably benign 0.21
R6325:Acoxl UTSW 2 128123024 missense probably benign 0.02
R6800:Acoxl UTSW 2 128010165 missense probably damaging 1.00
R7027:Acoxl UTSW 2 128010083 missense probably benign
R7098:Acoxl UTSW 2 127854915 nonsense probably null
R7165:Acoxl UTSW 2 128123108 missense probably benign
R7395:Acoxl UTSW 2 127884416 missense probably damaging 1.00
R7697:Acoxl UTSW 2 127978782 missense probably benign 0.01
Z1088:Acoxl UTSW 2 127872195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACAAGGTCGAGTCTAGGGCC -3'
(R):5'- TGTATACTCCCTGGAAAGACCC -3'

Sequencing Primer
(F):5'- TCGAGTCTAGGGCCAGCTATATAG -3'
(R):5'- CTCCTTCGAGAACAGACA -3'
Posted On2014-10-01