Incidental Mutation 'R2168:Flg2'
ID 235595
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 040171-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R2168 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93109244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 424 (S424L)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: S424L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: S424L

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,720,701 (GRCm39) I188N probably damaging Het
Akr1c14 T C 13: 4,131,106 (GRCm39) V266A probably damaging Het
Als2cl C A 9: 110,717,810 (GRCm39) P301H probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Catspere2 C T 1: 177,843,477 (GRCm39) probably benign Het
Cpsf1 A T 15: 76,487,937 (GRCm39) N53K possibly damaging Het
Ctsll3 C T 13: 60,948,749 (GRCm39) G69R possibly damaging Het
F2 C T 2: 91,458,693 (GRCm39) R539Q probably damaging Het
Fam78b G A 1: 166,906,219 (GRCm39) G126D probably damaging Het
Fancd2 A G 6: 113,568,120 (GRCm39) I1332V possibly damaging Het
Fpr1 T C 17: 18,097,471 (GRCm39) T173A possibly damaging Het
Gas2l3 A G 10: 89,249,960 (GRCm39) V386A probably benign Het
Gdap2 A C 3: 100,095,199 (GRCm39) E269A probably benign Het
Igf2bp2 T A 16: 21,898,358 (GRCm39) probably null Het
Ipo11 T C 13: 107,016,118 (GRCm39) probably null Het
Itpr2 G T 6: 146,013,176 (GRCm39) P2667Q probably benign Het
Itsn2 G T 12: 4,683,044 (GRCm39) probably benign Het
Jakmip2 A G 18: 43,698,995 (GRCm39) L488P probably damaging Het
Lrp1b A T 2: 41,265,858 (GRCm39) C248S probably damaging Het
Lrrc17 A T 5: 21,780,046 (GRCm39) D340V probably damaging Het
Megf9 T C 4: 70,351,679 (GRCm39) T481A probably damaging Het
Mrc1 T C 2: 14,249,015 (GRCm39) S184P possibly damaging Het
Msh4 A T 3: 153,573,472 (GRCm39) Y533* probably null Het
Mug1 A G 6: 121,847,458 (GRCm39) N612S probably benign Het
Nectin2 G T 7: 19,464,539 (GRCm39) S288R probably damaging Het
Neurog2 A T 3: 127,427,754 (GRCm39) H126L probably damaging Het
Nol10 A T 12: 17,423,585 (GRCm39) E310V probably damaging Het
Or1f12 T G 13: 21,721,422 (GRCm39) K251T probably damaging Het
Or4c29 A G 2: 88,740,522 (GRCm39) S72P probably damaging Het
Or51h7 A T 7: 102,591,678 (GRCm39) F35L probably benign Het
Or5h23 T A 16: 58,905,949 (GRCm39) K299I probably benign Het
Pappa A C 4: 65,074,682 (GRCm39) D412A probably damaging Het
Pcdhb7 T A 18: 37,476,335 (GRCm39) F490L probably benign Het
Pcsk1 T A 13: 75,260,653 (GRCm39) probably benign Het
Plekhn1 T A 4: 156,306,339 (GRCm39) D577V probably damaging Het
Prrc2c C A 1: 162,537,903 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Pzp G A 6: 128,465,010 (GRCm39) T1288M probably damaging Het
Radil A C 5: 142,492,718 (GRCm39) H63Q probably benign Het
Rai1 T C 11: 60,078,422 (GRCm39) S829P probably benign Het
Rd3 A G 1: 191,715,488 (GRCm39) I88V probably damaging Het
Rfesd T C 13: 76,156,244 (GRCm39) D54G probably damaging Het
Rnf213 A C 11: 119,305,896 (GRCm39) K568T probably damaging Het
Scaper T A 9: 55,650,923 (GRCm39) K913N probably damaging Het
Serpina3c T C 12: 104,115,628 (GRCm39) probably null Het
Serpinb6d A T 13: 33,850,357 (GRCm39) K61N probably benign Het
Skint4 A T 4: 111,944,183 (GRCm39) probably null Het
Sod1 T C 16: 90,017,801 (GRCm39) I19T possibly damaging Het
Stfa3 C A 16: 36,271,042 (GRCm39) G81* probably null Het
Ubr4 A G 4: 139,137,960 (GRCm39) T1106A probably benign Het
Uggt2 T A 14: 119,256,917 (GRCm39) N1106Y probably damaging Het
Vmn1r217 G A 13: 23,298,714 (GRCm39) Q63* probably null Het
Vmn2r129 A T 4: 156,690,673 (GRCm39) noncoding transcript Het
Vps13b C A 15: 35,792,334 (GRCm39) P2201T probably damaging Het
Vps13b C A 15: 35,792,335 (GRCm39) P2201Q probably damaging Het
Vps13d G T 4: 144,813,893 (GRCm39) probably benign Het
Zer1 A G 2: 29,994,887 (GRCm39) C503R probably damaging Het
Zfp369 T C 13: 65,444,762 (GRCm39) V635A probably benign Het
Zfp608 A T 18: 55,031,125 (GRCm39) Y938* probably null Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGAATGGGTTCAAGTCACTC -3'
(R):5'- TGACCTGAGCCAGATCCATG -3'

Sequencing Primer
(F):5'- AGAATGGGTTCAAGTCACTCTTCTTG -3'
(R):5'- ATGCTGCCCATAGTGACATG -3'
Posted On 2014-10-01