Incidental Mutation 'R2168:Flg2'
ID 235595
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 040171-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R2168 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 93197278-93221391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93201937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 424 (S424L)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: S424L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: S424L

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,878,781 I188N probably damaging Het
Akr1c14 T C 13: 4,081,106 V266A probably damaging Het
Als2cl C A 9: 110,888,742 P301H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cpsf1 A T 15: 76,603,737 N53K possibly damaging Het
Ctsll3 C T 13: 60,800,935 G69R possibly damaging Het
F2 C T 2: 91,628,348 R539Q probably damaging Het
Fam78b G A 1: 167,078,650 G126D probably damaging Het
Fancd2 A G 6: 113,591,159 I1332V possibly damaging Het
Fpr1 T C 17: 17,877,209 T173A possibly damaging Het
Gas2l3 A G 10: 89,414,098 V386A probably benign Het
Gdap2 A C 3: 100,187,883 E269A probably benign Het
Gm16432 C T 1: 178,015,911 probably benign Het
Igf2bp2 T A 16: 22,079,608 probably null Het
Ipo11 T C 13: 106,879,610 probably null Het
Itpr2 G T 6: 146,111,678 P2667Q probably benign Het
Itsn2 G T 12: 4,633,044 probably benign Het
Jakmip2 A G 18: 43,565,930 L488P probably damaging Het
Lrp1b A T 2: 41,375,846 C248S probably damaging Het
Lrrc17 A T 5: 21,575,048 D340V probably damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mrc1 T C 2: 14,244,204 S184P possibly damaging Het
Msh4 A T 3: 153,867,835 Y533* probably null Het
Mug1 A G 6: 121,870,499 N612S probably benign Het
Nectin2 G T 7: 19,730,614 S288R probably damaging Het
Neurog2 A T 3: 127,634,105 H126L probably damaging Het
Nol10 A T 12: 17,373,584 E310V probably damaging Het
Olfr1209 A G 2: 88,910,178 S72P probably damaging Het
Olfr1366 T G 13: 21,537,252 K251T probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr573-ps1 A T 7: 102,942,471 F35L probably benign Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Pcdhb7 T A 18: 37,343,282 F490L probably benign Het
Pcsk1 T A 13: 75,112,534 probably benign Het
Plekhn1 T A 4: 156,221,882 D577V probably damaging Het
Prrc2c C A 1: 162,710,334 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pzp G A 6: 128,488,047 T1288M probably damaging Het
Radil A C 5: 142,506,963 H63Q probably benign Het
Rai1 T C 11: 60,187,596 S829P probably benign Het
Rd3 A G 1: 191,983,527 I88V probably damaging Het
Rfesd T C 13: 76,008,125 D54G probably damaging Het
Rnf213 A C 11: 119,415,070 K568T probably damaging Het
Scaper T A 9: 55,743,639 K913N probably damaging Het
Serpina3c T C 12: 104,149,369 probably null Het
Serpinb6d A T 13: 33,666,374 K61N probably benign Het
Skint4 A T 4: 112,086,986 probably null Het
Sod1 T C 16: 90,220,913 I19T possibly damaging Het
Stfa3 C A 16: 36,450,680 G81* probably null Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Uggt2 T A 14: 119,019,505 N1106Y probably damaging Het
Vmn1r217 G A 13: 23,114,544 Q63* probably null Het
Vmn2r-ps159 A T 4: 156,338,378 noncoding transcript Het
Vps13b C A 15: 35,792,188 P2201T probably damaging Het
Vps13b C A 15: 35,792,189 P2201Q probably damaging Het
Vps13d G T 4: 145,087,323 probably benign Het
Zer1 A G 2: 30,104,875 C503R probably damaging Het
Zfp369 T C 13: 65,296,948 V635A probably benign Het
Zfp608 A T 18: 54,898,053 Y938* probably null Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
R9214:Flg2 UTSW 3 93203577 missense unknown
R9231:Flg2 UTSW 3 93202201 missense unknown
R9553:Flg2 UTSW 3 93214594 missense unknown
R9607:Flg2 UTSW 3 93201412 missense probably damaging 0.98
R9735:Flg2 UTSW 3 93220362 missense unknown
R9752:Flg2 UTSW 3 93201160 missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGAATGGGTTCAAGTCACTC -3'
(R):5'- TGACCTGAGCCAGATCCATG -3'

Sequencing Primer
(F):5'- AGAATGGGTTCAAGTCACTCTTCTTG -3'
(R):5'- ATGCTGCCCATAGTGACATG -3'
Posted On 2014-10-01