Mutagenetix > Incidental Mutation

Incidental Mutation 'R2168:Msh4'

235598

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

MMRRC Submission

040171-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.477) question?

Stock #

R2168 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 153867835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 533 (Y533*)

Ref Sequence

ENSEMBL: ENSMUSP00000140265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

AlphaFold

Q99MT2

Predicted Effect

probably null
Transcript: ENSMUST00000005630
AA Change: Y727*

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: Y727*

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186220

Predicted Effect

probably null
Transcript: ENSMUST00000188338
AA Change: Y639*

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: Y639*

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189189

Predicted Effect

probably null
Transcript: ENSMUST00000190449
AA Change: Y533*

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: Y533*

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191606

Meta Mutation Damage Score

0.9716

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	T	A	2: 127,878,781	I188N	probably damaging	Het
Akr1c14	T	C	13: 4,081,106	V266A	probably damaging	Het
Als2cl	C	A	9: 110,888,742	P301H	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Cpsf1	A	T	15: 76,603,737	N53K	possibly damaging	Het
Ctsll3	C	T	13: 60,800,935	G69R	possibly damaging	Het
F2	C	T	2: 91,628,348	R539Q	probably damaging	Het
Fam78b	G	A	1: 167,078,650	G126D	probably damaging	Het
Fancd2	A	G	6: 113,591,159	I1332V	possibly damaging	Het
Flg2	C	T	3: 93,201,937	S424L	probably damaging	Het
Fpr1	T	C	17: 17,877,209	T173A	possibly damaging	Het
Gas2l3	A	G	10: 89,414,098	V386A	probably benign	Het
Gdap2	A	C	3: 100,187,883	E269A	probably benign	Het
Gm16432	C	T	1: 178,015,911		probably benign	Het
Igf2bp2	T	A	16: 22,079,608		probably null	Het
Ipo11	T	C	13: 106,879,610		probably null	Het
Itpr2	G	T	6: 146,111,678	P2667Q	probably benign	Het
Itsn2	G	T	12: 4,633,044		probably benign	Het
Jakmip2	A	G	18: 43,565,930	L488P	probably damaging	Het
Lrp1b	A	T	2: 41,375,846	C248S	probably damaging	Het
Lrrc17	A	T	5: 21,575,048	D340V	probably damaging	Het
Megf9	T	C	4: 70,433,442	T481A	probably damaging	Het
Mrc1	T	C	2: 14,244,204	S184P	possibly damaging	Het
Mug1	A	G	6: 121,870,499	N612S	probably benign	Het
Nectin2	G	T	7: 19,730,614	S288R	probably damaging	Het
Neurog2	A	T	3: 127,634,105	H126L	probably damaging	Het
Nol10	A	T	12: 17,373,584	E310V	probably damaging	Het
Olfr1209	A	G	2: 88,910,178	S72P	probably damaging	Het
Olfr1366	T	G	13: 21,537,252	K251T	probably damaging	Het
Olfr191	T	A	16: 59,085,586	K299I	probably benign	Het
Olfr573-ps1	A	T	7: 102,942,471	F35L	probably benign	Het
Pappa	A	C	4: 65,156,445	D412A	probably damaging	Het
Pcdhb7	T	A	18: 37,343,282	F490L	probably benign	Het
Pcsk1	T	A	13: 75,112,534		probably benign	Het
Plekhn1	T	A	4: 156,221,882	D577V	probably damaging	Het
Prrc2c	C	A	1: 162,710,334		probably benign	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Pzp	G	A	6: 128,488,047	T1288M	probably damaging	Het
Radil	A	C	5: 142,506,963	H63Q	probably benign	Het
Rai1	T	C	11: 60,187,596	S829P	probably benign	Het
Rd3	A	G	1: 191,983,527	I88V	probably damaging	Het
Rfesd	T	C	13: 76,008,125	D54G	probably damaging	Het
Rnf213	A	C	11: 119,415,070	K568T	probably damaging	Het
Scaper	T	A	9: 55,743,639	K913N	probably damaging	Het
Serpina3c	T	C	12: 104,149,369		probably null	Het
Serpinb6d	A	T	13: 33,666,374	K61N	probably benign	Het
Skint4	A	T	4: 112,086,986		probably null	Het
Sod1	T	C	16: 90,220,913	I19T	possibly damaging	Het
Stfa3	C	A	16: 36,450,680	G81*	probably null	Het
Ubr4	A	G	4: 139,410,649	T1106A	probably benign	Het
Uggt2	T	A	14: 119,019,505	N1106Y	probably damaging	Het
Vmn1r217	G	A	13: 23,114,544	Q63*	probably null	Het
Vmn2r-ps159	A	T	4: 156,338,378		noncoding transcript	Het
Vps13b	C	A	15: 35,792,188	P2201T	probably damaging	Het
Vps13b	C	A	15: 35,792,189	P2201Q	probably damaging	Het
Vps13d	G	T	4: 145,087,323		probably benign	Het
Zer1	A	G	2: 30,104,875	C503R	probably damaging	Het
Zfp369	T	C	13: 65,296,948	V635A	probably benign	Het
Zfp608	A	T	18: 54,898,053	Y938*	probably null	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0368:Msh4	UTSW	3	153888825	missense	probably damaging	1.00
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0632:Msh4	UTSW	3	153896895	missense	probably damaging	1.00
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1081:Msh4	UTSW	3	153872358	missense	probably benign	0.06
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1669:Msh4	UTSW	3	153876720	missense	possibly damaging	0.47
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2378:Msh4	UTSW	3	153863477	missense	probably damaging	0.99
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R7990:Msh4	UTSW	3	153896892	missense	probably damaging	1.00
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
R8805:Msh4	UTSW	3	153857633	missense	probably benign	0.00
R8814:Msh4	UTSW	3	153872320	missense	probably damaging	1.00
R8861:Msh4	UTSW	3	153901468	missense	probably benign	0.04
R8970:Msh4	UTSW	3	153869732	nonsense	probably null
R9010:Msh4	UTSW	3	153890182	missense	probably benign	0.30
R9338:Msh4	UTSW	3	153867807	missense	possibly damaging	0.55
R9598:Msh4	UTSW	3	153901511	missense	possibly damaging	0.93
R9780:Msh4	UTSW	3	153876705	missense	probably damaging	1.00
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCTCTCAGGAACTAAAGTGC -3'
(R):5'- TGCACAACCTTGTATGGCAG -3'

Sequencing Primer
(F):5'- GCACCAGCAAGTCTGAATGC -3'
(R):5'- AGCTTATGGAGTGAGCAG -3'

Posted On

2014-10-01