Incidental Mutation 'R2168:Msh4'
ID235598
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene NamemutS homolog 4
SynonymsmMsh4, 4930485C04Rik
MMRRC Submission 040171-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R2168 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location153857149-153906138 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 153867835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 533 (Y533*)
Ref Sequence ENSEMBL: ENSMUSP00000140265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
Predicted Effect probably null
Transcript: ENSMUST00000005630
AA Change: Y727*
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: Y727*

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186220
Predicted Effect probably null
Transcript: ENSMUST00000188338
AA Change: Y639*
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: Y639*

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189189
Predicted Effect probably null
Transcript: ENSMUST00000190449
AA Change: Y533*
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: Y533*

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191606
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,878,781 I188N probably damaging Het
Akr1c14 T C 13: 4,081,106 V266A probably damaging Het
Als2cl C A 9: 110,888,742 P301H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cpsf1 A T 15: 76,603,737 N53K possibly damaging Het
Ctsll3 C T 13: 60,800,935 G69R possibly damaging Het
F2 C T 2: 91,628,348 R539Q probably damaging Het
Fam78b G A 1: 167,078,650 G126D probably damaging Het
Fancd2 A G 6: 113,591,159 I1332V possibly damaging Het
Flg2 C T 3: 93,201,937 S424L probably damaging Het
Fpr1 T C 17: 17,877,209 T173A possibly damaging Het
Gas2l3 A G 10: 89,414,098 V386A probably benign Het
Gdap2 A C 3: 100,187,883 E269A probably benign Het
Gm16432 C T 1: 178,015,911 probably benign Het
Igf2bp2 T A 16: 22,079,608 probably null Het
Ipo11 T C 13: 106,879,610 probably null Het
Itpr2 G T 6: 146,111,678 P2667Q probably benign Het
Itsn2 G T 12: 4,633,044 probably benign Het
Jakmip2 A G 18: 43,565,930 L488P probably damaging Het
Lrp1b A T 2: 41,375,846 C248S probably damaging Het
Lrrc17 A T 5: 21,575,048 D340V probably damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mrc1 T C 2: 14,244,204 S184P possibly damaging Het
Mug1 A G 6: 121,870,499 N612S probably benign Het
Nectin2 G T 7: 19,730,614 S288R probably damaging Het
Neurog2 A T 3: 127,634,105 H126L probably damaging Het
Nol10 A T 12: 17,373,584 E310V probably damaging Het
Olfr1209 A G 2: 88,910,178 S72P probably damaging Het
Olfr1366 T G 13: 21,537,252 K251T probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr573-ps1 A T 7: 102,942,471 F35L probably benign Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Pcdhb7 T A 18: 37,343,282 F490L probably benign Het
Pcsk1 T A 13: 75,112,534 probably benign Het
Plekhn1 T A 4: 156,221,882 D577V probably damaging Het
Prrc2c C A 1: 162,710,334 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pzp G A 6: 128,488,047 T1288M probably damaging Het
Radil A C 5: 142,506,963 H63Q probably benign Het
Rai1 T C 11: 60,187,596 S829P probably benign Het
Rd3 A G 1: 191,983,527 I88V probably damaging Het
Rfesd T C 13: 76,008,125 D54G probably damaging Het
Rnf213 A C 11: 119,415,070 K568T probably damaging Het
Scaper T A 9: 55,743,639 K913N probably damaging Het
Serpina3c T C 12: 104,149,369 probably null Het
Serpinb6d A T 13: 33,666,374 K61N probably benign Het
Skint4 A T 4: 112,086,986 probably null Het
Sod1 T C 16: 90,220,913 I19T possibly damaging Het
Stfa3 C A 16: 36,450,680 G81* probably null Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Uggt2 T A 14: 119,019,505 N1106Y probably damaging Het
Vmn1r217 G A 13: 23,114,544 Q63* probably null Het
Vmn2r-ps159 A T 4: 156,338,378 noncoding transcript Het
Vps13b C A 15: 35,792,188 P2201T probably damaging Het
Vps13b C A 15: 35,792,189 P2201Q probably damaging Het
Vps13d G T 4: 145,087,323 probably benign Het
Zer1 A G 2: 30,104,875 C503R probably damaging Het
Zfp369 T C 13: 65,296,948 V635A probably benign Het
Zfp608 A T 18: 54,898,053 Y938* probably null Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153883735 missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153877982 splice site probably benign
IGL01609:Msh4 APN 3 153897397 missense probably damaging 1.00
IGL01785:Msh4 APN 3 153857507 missense probably damaging 1.00
IGL01939:Msh4 APN 3 153857589 missense probably damaging 1.00
IGL02022:Msh4 APN 3 153886956 missense probably damaging 1.00
IGL02209:Msh4 APN 3 153888862 missense probably damaging 1.00
IGL02224:Msh4 APN 3 153890185 missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153873674 missense probably damaging 0.98
IGL02493:Msh4 APN 3 153877908 critical splice donor site probably null
IGL02576:Msh4 APN 3 153867746 missense probably damaging 1.00
IGL02616:Msh4 APN 3 153857523 missense probably benign
IGL02812:Msh4 APN 3 153901400 splice site probably benign
IGL02888:Msh4 APN 3 153896913 nonsense probably null
IGL02992:Msh4 APN 3 153872325 missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153869608 missense probably damaging 0.97
P0021:Msh4 UTSW 3 153888818 missense probably damaging 1.00
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0368:Msh4 UTSW 3 153888825 missense probably damaging 1.00
R0377:Msh4 UTSW 3 153896890 missense probably benign 0.00
R0631:Msh4 UTSW 3 153866420 missense probably benign 0.02
R0632:Msh4 UTSW 3 153896895 missense probably damaging 1.00
R0677:Msh4 UTSW 3 153879367 missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153863504 missense probably benign 0.00
R1081:Msh4 UTSW 3 153872358 missense probably benign 0.06
R1463:Msh4 UTSW 3 153857570 missense probably damaging 1.00
R1476:Msh4 UTSW 3 153863384 missense probably damaging 1.00
R1669:Msh4 UTSW 3 153876720 missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153867767 missense probably damaging 1.00
R1859:Msh4 UTSW 3 153905880 missense probably benign
R2378:Msh4 UTSW 3 153863477 missense probably damaging 0.99
R2991:Msh4 UTSW 3 153905860 missense probably benign
R3025:Msh4 UTSW 3 153863491 missense probably damaging 1.00
R4604:Msh4 UTSW 3 153872283 missense probably damaging 1.00
R4757:Msh4 UTSW 3 153879387 missense probably damaging 0.99
R5205:Msh4 UTSW 3 153866412 missense probably damaging 1.00
R5285:Msh4 UTSW 3 153873713 missense probably benign 0.03
R5766:Msh4 UTSW 3 153867840 missense probably damaging 1.00
R5777:Msh4 UTSW 3 153863439 missense probably benign 0.01
R5888:Msh4 UTSW 3 153867723 critical splice donor site probably null
R7384:Msh4 UTSW 3 153888748 missense probably benign 0.23
R7408:Msh4 UTSW 3 153876745 missense probably benign 0.06
R7487:Msh4 UTSW 3 153863510 missense probably damaging 1.00
R7503:Msh4 UTSW 3 153867750 missense probably damaging 1.00
R7726:Msh4 UTSW 3 153866320 critical splice donor site probably null
R7990:Msh4 UTSW 3 153896892 missense probably damaging 1.00
R8097:Msh4 UTSW 3 153877908 critical splice donor site probably null
R8805:Msh4 UTSW 3 153857633 missense probably benign 0.00
R8814:Msh4 UTSW 3 153872320 missense probably damaging 1.00
R8861:Msh4 UTSW 3 153901468 missense probably benign 0.04
Z1177:Msh4 UTSW 3 153879368 missense probably benign 0.00
Z1177:Msh4 UTSW 3 153901443 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCTCAGGAACTAAAGTGC -3'
(R):5'- TGCACAACCTTGTATGGCAG -3'

Sequencing Primer
(F):5'- GCACCAGCAAGTCTGAATGC -3'
(R):5'- AGCTTATGGAGTGAGCAG -3'
Posted On2014-10-01