Incidental Mutation 'R2168:Cpsf1'
ID235637
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission 040171-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R2168 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76603737 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 53 (N53K)
Ref Sequence ENSEMBL: ENSMUSP00000155098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably benign
Transcript: ENSMUST00000071898
AA Change: N53K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: N53K

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229982
Predicted Effect probably benign
Transcript: ENSMUST00000230157
AA Change: N53K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231037
Predicted Effect possibly damaging
Transcript: ENSMUST00000231042
AA Change: N53K

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231191
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,878,781 I188N probably damaging Het
Akr1c14 T C 13: 4,081,106 V266A probably damaging Het
Als2cl C A 9: 110,888,742 P301H probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ctsll3 C T 13: 60,800,935 G69R possibly damaging Het
F2 C T 2: 91,628,348 R539Q probably damaging Het
Fam78b G A 1: 167,078,650 G126D probably damaging Het
Fancd2 A G 6: 113,591,159 I1332V possibly damaging Het
Flg2 C T 3: 93,201,937 S424L probably damaging Het
Fpr1 T C 17: 17,877,209 T173A possibly damaging Het
Gas2l3 A G 10: 89,414,098 V386A probably benign Het
Gdap2 A C 3: 100,187,883 E269A probably benign Het
Gm16432 C T 1: 178,015,911 probably benign Het
Igf2bp2 T A 16: 22,079,608 probably null Het
Ipo11 T C 13: 106,879,610 probably null Het
Itpr2 G T 6: 146,111,678 P2667Q probably benign Het
Itsn2 G T 12: 4,633,044 probably benign Het
Jakmip2 A G 18: 43,565,930 L488P probably damaging Het
Lrp1b A T 2: 41,375,846 C248S probably damaging Het
Lrrc17 A T 5: 21,575,048 D340V probably damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mrc1 T C 2: 14,244,204 S184P possibly damaging Het
Msh4 A T 3: 153,867,835 Y533* probably null Het
Mug1 A G 6: 121,870,499 N612S probably benign Het
Nectin2 G T 7: 19,730,614 S288R probably damaging Het
Neurog2 A T 3: 127,634,105 H126L probably damaging Het
Nol10 A T 12: 17,373,584 E310V probably damaging Het
Olfr1209 A G 2: 88,910,178 S72P probably damaging Het
Olfr1366 T G 13: 21,537,252 K251T probably damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr573-ps1 A T 7: 102,942,471 F35L probably benign Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Pcdhb7 T A 18: 37,343,282 F490L probably benign Het
Pcsk1 T A 13: 75,112,534 probably benign Het
Plekhn1 T A 4: 156,221,882 D577V probably damaging Het
Prrc2c C A 1: 162,710,334 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pzp G A 6: 128,488,047 T1288M probably damaging Het
Radil A C 5: 142,506,963 H63Q probably benign Het
Rai1 T C 11: 60,187,596 S829P probably benign Het
Rd3 A G 1: 191,983,527 I88V probably damaging Het
Rfesd T C 13: 76,008,125 D54G probably damaging Het
Rnf213 A C 11: 119,415,070 K568T probably damaging Het
Scaper T A 9: 55,743,639 K913N probably damaging Het
Serpina3c T C 12: 104,149,369 probably null Het
Serpinb6d A T 13: 33,666,374 K61N probably benign Het
Skint4 A T 4: 112,086,986 probably null Het
Sod1 T C 16: 90,220,913 I19T possibly damaging Het
Stfa3 C A 16: 36,450,680 G81* probably null Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Uggt2 T A 14: 119,019,505 N1106Y probably damaging Het
Vmn1r217 G A 13: 23,114,544 Q63* probably null Het
Vmn2r-ps159 A T 4: 156,338,378 noncoding transcript Het
Vps13b C A 15: 35,792,188 P2201T probably damaging Het
Vps13b C A 15: 35,792,189 P2201Q probably damaging Het
Vps13d G T 4: 145,087,323 probably benign Het
Zer1 A G 2: 30,104,875 C503R probably damaging Het
Zfp369 T C 13: 65,296,948 V635A probably benign Het
Zfp608 A T 18: 54,898,053 Y938* probably null Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0487:Cpsf1 UTSW 15 76597002 missense probably damaging 1.00
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2697:Cpsf1 UTSW 15 76599329 missense probably damaging 1.00
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R3815:Cpsf1 UTSW 15 76601149 missense probably benign 0.22
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6621:Cpsf1 UTSW 15 76603519 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R7446:Cpsf1 UTSW 15 76601750 missense probably benign
R7612:Cpsf1 UTSW 15 76597009 missense probably benign 0.00
R7739:Cpsf1 UTSW 15 76600311 missense probably benign 0.00
R7878:Cpsf1 UTSW 15 76600500 missense probably damaging 1.00
R8334:Cpsf1 UTSW 15 76603587 missense probably benign 0.26
R8345:Cpsf1 UTSW 15 76601490 missense probably benign
R8382:Cpsf1 UTSW 15 76600951 missense probably benign
R8403:Cpsf1 UTSW 15 76600283 missense probably damaging 0.96
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAAGCAAGGCATCACGTTTG -3'
(R):5'- AAACTGTGGCTTCCCAGTG -3'

Sequencing Primer
(F):5'- ATCACGTTTGGCGCCTG -3'
(R):5'- TTCCCAGTGATGAGCCATG -3'
Posted On2014-10-01