Incidental Mutation 'R2168:Jakmip2'
ID 235644
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 040171-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R2168 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 43664472-43820838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43698995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 488 (L488P)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably damaging
Transcript: ENSMUST00000082254
AA Change: L488P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: L488P

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Meta Mutation Damage Score 0.8705 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,720,701 (GRCm39) I188N probably damaging Het
Akr1c14 T C 13: 4,131,106 (GRCm39) V266A probably damaging Het
Als2cl C A 9: 110,717,810 (GRCm39) P301H probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Catspere2 C T 1: 177,843,477 (GRCm39) probably benign Het
Cpsf1 A T 15: 76,487,937 (GRCm39) N53K possibly damaging Het
Ctsll3 C T 13: 60,948,749 (GRCm39) G69R possibly damaging Het
F2 C T 2: 91,458,693 (GRCm39) R539Q probably damaging Het
Fam78b G A 1: 166,906,219 (GRCm39) G126D probably damaging Het
Fancd2 A G 6: 113,568,120 (GRCm39) I1332V possibly damaging Het
Flg2 C T 3: 93,109,244 (GRCm39) S424L probably damaging Het
Fpr1 T C 17: 18,097,471 (GRCm39) T173A possibly damaging Het
Gas2l3 A G 10: 89,249,960 (GRCm39) V386A probably benign Het
Gdap2 A C 3: 100,095,199 (GRCm39) E269A probably benign Het
Igf2bp2 T A 16: 21,898,358 (GRCm39) probably null Het
Ipo11 T C 13: 107,016,118 (GRCm39) probably null Het
Itpr2 G T 6: 146,013,176 (GRCm39) P2667Q probably benign Het
Itsn2 G T 12: 4,683,044 (GRCm39) probably benign Het
Lrp1b A T 2: 41,265,858 (GRCm39) C248S probably damaging Het
Lrrc17 A T 5: 21,780,046 (GRCm39) D340V probably damaging Het
Megf9 T C 4: 70,351,679 (GRCm39) T481A probably damaging Het
Mrc1 T C 2: 14,249,015 (GRCm39) S184P possibly damaging Het
Msh4 A T 3: 153,573,472 (GRCm39) Y533* probably null Het
Mug1 A G 6: 121,847,458 (GRCm39) N612S probably benign Het
Nectin2 G T 7: 19,464,539 (GRCm39) S288R probably damaging Het
Neurog2 A T 3: 127,427,754 (GRCm39) H126L probably damaging Het
Nol10 A T 12: 17,423,585 (GRCm39) E310V probably damaging Het
Or1f12 T G 13: 21,721,422 (GRCm39) K251T probably damaging Het
Or4c29 A G 2: 88,740,522 (GRCm39) S72P probably damaging Het
Or51h7 A T 7: 102,591,678 (GRCm39) F35L probably benign Het
Or5h23 T A 16: 58,905,949 (GRCm39) K299I probably benign Het
Pappa A C 4: 65,074,682 (GRCm39) D412A probably damaging Het
Pcdhb7 T A 18: 37,476,335 (GRCm39) F490L probably benign Het
Pcsk1 T A 13: 75,260,653 (GRCm39) probably benign Het
Plekhn1 T A 4: 156,306,339 (GRCm39) D577V probably damaging Het
Prrc2c C A 1: 162,537,903 (GRCm39) probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Pzp G A 6: 128,465,010 (GRCm39) T1288M probably damaging Het
Radil A C 5: 142,492,718 (GRCm39) H63Q probably benign Het
Rai1 T C 11: 60,078,422 (GRCm39) S829P probably benign Het
Rd3 A G 1: 191,715,488 (GRCm39) I88V probably damaging Het
Rfesd T C 13: 76,156,244 (GRCm39) D54G probably damaging Het
Rnf213 A C 11: 119,305,896 (GRCm39) K568T probably damaging Het
Scaper T A 9: 55,650,923 (GRCm39) K913N probably damaging Het
Serpina3c T C 12: 104,115,628 (GRCm39) probably null Het
Serpinb6d A T 13: 33,850,357 (GRCm39) K61N probably benign Het
Skint4 A T 4: 111,944,183 (GRCm39) probably null Het
Sod1 T C 16: 90,017,801 (GRCm39) I19T possibly damaging Het
Stfa3 C A 16: 36,271,042 (GRCm39) G81* probably null Het
Ubr4 A G 4: 139,137,960 (GRCm39) T1106A probably benign Het
Uggt2 T A 14: 119,256,917 (GRCm39) N1106Y probably damaging Het
Vmn1r217 G A 13: 23,298,714 (GRCm39) Q63* probably null Het
Vmn2r129 A T 4: 156,690,673 (GRCm39) noncoding transcript Het
Vps13b C A 15: 35,792,334 (GRCm39) P2201T probably damaging Het
Vps13b C A 15: 35,792,335 (GRCm39) P2201Q probably damaging Het
Vps13d G T 4: 144,813,893 (GRCm39) probably benign Het
Zer1 A G 2: 29,994,887 (GRCm39) C503R probably damaging Het
Zfp369 T C 13: 65,444,762 (GRCm39) V635A probably benign Het
Zfp608 A T 18: 55,031,125 (GRCm39) Y938* probably null Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43,723,744 (GRCm39) utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43,690,389 (GRCm39) splice site probably benign
IGL01467:Jakmip2 APN 18 43,715,352 (GRCm39) missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43,680,159 (GRCm39) missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43,692,158 (GRCm39) critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43,704,919 (GRCm39) missense probably benign
IGL02143:Jakmip2 APN 18 43,696,350 (GRCm39) missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43,700,223 (GRCm39) missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43,695,655 (GRCm39) missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43,708,516 (GRCm39) splice site probably benign
IGL02866:Jakmip2 APN 18 43,685,266 (GRCm39) missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43,695,595 (GRCm39) critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43,685,210 (GRCm39) splice site probably benign
R0044:Jakmip2 UTSW 18 43,715,170 (GRCm39) missense probably benign
R0436:Jakmip2 UTSW 18 43,691,234 (GRCm39) nonsense probably null
R1453:Jakmip2 UTSW 18 43,692,279 (GRCm39) splice site probably null
R1682:Jakmip2 UTSW 18 43,714,896 (GRCm39) critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43,715,145 (GRCm39) missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43,700,209 (GRCm39) missense probably benign
R2070:Jakmip2 UTSW 18 43,696,395 (GRCm39) missense probably benign 0.34
R2985:Jakmip2 UTSW 18 43,704,246 (GRCm39) missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43,682,751 (GRCm39) missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43,695,657 (GRCm39) missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43,710,477 (GRCm39) missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43,700,208 (GRCm39) missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43,710,465 (GRCm39) missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43,701,173 (GRCm39) missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43,715,025 (GRCm39) missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43,692,181 (GRCm39) missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43,715,059 (GRCm39) missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43,708,599 (GRCm39) missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43,704,244 (GRCm39) missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43,689,589 (GRCm39) missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43,690,432 (GRCm39) missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43,699,014 (GRCm39) missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43,690,393 (GRCm39) critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43,673,648 (GRCm39) splice site probably null
R7434:Jakmip2 UTSW 18 43,690,444 (GRCm39) missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43,710,390 (GRCm39) missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43,704,191 (GRCm39) missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43,673,676 (GRCm39) missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43,704,973 (GRCm39) missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43,696,398 (GRCm39) missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43,715,323 (GRCm39) missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43,715,352 (GRCm39) missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43,685,242 (GRCm39) missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43,715,194 (GRCm39) missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43,704,961 (GRCm39) missense probably benign
R9691:Jakmip2 UTSW 18 43,673,685 (GRCm39) missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43,704,927 (GRCm39) missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43,699,035 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAGCACAAAGAAATATGTGCCG -3'
(R):5'- GTAAAGGTTAAAGTATCCTTGCCTC -3'

Sequencing Primer
(F):5'- GCTGACATTTTAAGGGCCAC -3'
(R):5'- ACATCCAAACTTTGATTGTGTCTTC -3'
Posted On 2014-10-01