Incidental Mutation 'R2169:Ythdf1'
ID235650
Institutional Source Beutler Lab
Gene Symbol Ythdf1
Ensembl Gene ENSMUSG00000038848
Gene NameYTH domain family 1
Synonyms
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180904377-180920949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 180912114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 69 (S69T)
Ref Sequence ENSEMBL: ENSMUSP00000116665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037299] [ENSMUST00000108876] [ENSMUST00000124666]
Predicted Effect probably damaging
Transcript: ENSMUST00000037299
AA Change: S76T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037808
Gene: ENSMUSG00000038848
AA Change: S76T

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 279 326 N/A INTRINSIC
Pfam:YTH 388 526 4.2e-51 PFAM
low complexity region 540 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108876
AA Change: S103T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104504
Gene: ENSMUSG00000038848
AA Change: S103T

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 306 353 N/A INTRINSIC
Pfam:YTH 416 551 1.9e-46 PFAM
low complexity region 567 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124666
AA Change: S69T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116665
Gene: ENSMUSG00000038848
AA Change: S69T

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Ythdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Ythdf1 APN 2 180911693 missense probably damaging 0.99
IGL03066:Ythdf1 APN 2 180911546 missense probably damaging 1.00
Agitated UTSW 2 180919133 critical splice donor site probably null
R1258:Ythdf1 UTSW 2 180911310 missense probably benign 0.05
R1541:Ythdf1 UTSW 2 180919143 missense probably damaging 1.00
R1738:Ythdf1 UTSW 2 180911492 missense probably benign 0.00
R1856:Ythdf1 UTSW 2 180910970 missense probably damaging 1.00
R4606:Ythdf1 UTSW 2 180912182 missense probably damaging 0.97
R5296:Ythdf1 UTSW 2 180912188 missense probably damaging 0.98
R6250:Ythdf1 UTSW 2 180911100 missense probably damaging 1.00
R6254:Ythdf1 UTSW 2 180911150 missense probably damaging 1.00
R6702:Ythdf1 UTSW 2 180919133 critical splice donor site probably null
R7102:Ythdf1 UTSW 2 180911522 missense probably damaging 1.00
R7409:Ythdf1 UTSW 2 180911993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCTGAGCTCTGAGTCTG -3'
(R):5'- ATATTAGGCTGGTTTCTGCACC -3'

Sequencing Primer
(F):5'- TGCCCCTGAGAACCACTTG -3'
(R):5'- ACCTGTGTATGAGGTGGTCAGC -3'
Posted On2014-10-01