Incidental Mutation 'R2169:Muc1'
ID235652
Institutional Source Beutler Lab
Gene Symbol Muc1
Ensembl Gene ENSMUSG00000042784
Gene Namemucin 1, transmembrane
SynonymsEMA, CD227, Muc-1
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89229057-89233381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89231596 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 504 (E504G)
Ref Sequence ENSEMBL: ENSMUSP00000041963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000041022] [ENSMUST00000041142] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000119084] [ENSMUST00000143637] [ENSMUST00000174126]
Predicted Effect probably benign
Transcript: ENSMUST00000029682
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041022
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000041142
AA Change: E504G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784
AA Change: E504G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000090924
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102300
Predicted Effect probably benign
Transcript: ENSMUST00000107464
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119084
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect probably benign
Transcript: ENSMUST00000136881
SMART Domains Protein: ENSMUSP00000120337
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
Pfam:TSP_3 1 31 5.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139419
Predicted Effect probably benign
Transcript: ENSMUST00000143637
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174324
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display delayed mammary tumor progression, impaired intestinal absorption of cholesterol, decreased gastric mucus accumulation, reduced secretion and accumulation of gallbladder mucin, and decreased susceptibility to cholesterol gallstone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Muc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Muc1 APN 3 89230754 missense probably benign 0.01
IGL01549:Muc1 APN 3 89231810 missense probably damaging 1.00
IGL01969:Muc1 APN 3 89232006 missense probably damaging 1.00
IGL02233:Muc1 APN 3 89231628 missense probably benign 0.11
IGL03160:Muc1 APN 3 89233024 missense possibly damaging 0.89
R0670:Muc1 UTSW 3 89230532 missense probably benign 0.00
R0682:Muc1 UTSW 3 89231132 missense probably damaging 1.00
R0702:Muc1 UTSW 3 89230220 missense probably benign 0.00
R0744:Muc1 UTSW 3 89230328 missense possibly damaging 0.92
R1137:Muc1 UTSW 3 89230438 missense probably benign 0.00
R1270:Muc1 UTSW 3 89232107 missense probably damaging 1.00
R1673:Muc1 UTSW 3 89231772 missense possibly damaging 0.76
R1869:Muc1 UTSW 3 89231810 missense probably damaging 1.00
R4460:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4461:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4672:Muc1 UTSW 3 89232077 missense probably damaging 0.99
R5892:Muc1 UTSW 3 89230993 missense probably benign 0.04
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6931:Muc1 UTSW 3 89229159 unclassified probably benign
R7400:Muc1 UTSW 3 89230646 missense possibly damaging 0.63
R8210:Muc1 UTSW 3 89231599 missense probably damaging 1.00
R8258:Muc1 UTSW 3 89232034 missense probably damaging 1.00
R8259:Muc1 UTSW 3 89232034 missense probably damaging 1.00
X0065:Muc1 UTSW 3 89230286 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGAATGGTCAGTCTCGTGAC -3'
(R):5'- TGAGACTTACCAGGGCAAGG -3'

Sequencing Primer
(F):5'- CTCGTGACTTTGTGGTGTCG -3'
(R):5'- GAGGGAACTGCATCTCATTCACTAG -3'
Posted On2014-10-01