Incidental Mutation 'R2169:Fam69a'
ID235660
Institutional Source Beutler Lab
Gene Symbol Fam69a
Ensembl Gene ENSMUSG00000029270
Gene Namefamily with sequence similarity 69, member A
Synonyms
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107908053-107987085 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 107909459 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 411 (L411*)
Ref Sequence ENSEMBL: ENSMUSP00000031198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000145239] [ENSMUST00000153172] [ENSMUST00000153590]
Predicted Effect probably null
Transcript: ENSMUST00000031198
AA Change: L411*
SMART Domains Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270
AA Change: L411*

DomainStartEndE-ValueType
PIP49_N 19 177 1.7e-92 SMART
Pfam:PIP49_C 194 396 1.9e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082223
SMART Domains Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
Pfam:Ribosomal_L18p 26 173 2.1e-46 PFAM
Pfam:Ribosomal_L18_c 192 283 2.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140659
Predicted Effect probably benign
Transcript: ENSMUST00000145239
SMART Domains Protein: ENSMUSP00000117801
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 1 132 1.18e-45 SMART
Pfam:PIP49_C 149 284 2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151767
Predicted Effect probably benign
Transcript: ENSMUST00000153172
SMART Domains Protein: ENSMUSP00000114892
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 24 87 1.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153590
SMART Domains Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558

DomainStartEndE-ValueType
Pfam:Ribosomal_L18p 1 123 6.3e-37 PFAM
Pfam:Ribosomal_L18_c 142 163 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Fam69a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Fam69a APN 5 107911781 missense probably benign 0.24
R1799:Fam69a UTSW 5 107909847 missense probably damaging 0.98
R2048:Fam69a UTSW 5 107910020 missense probably damaging 0.98
R2408:Fam69a UTSW 5 107914425 missense possibly damaging 0.90
R3085:Fam69a UTSW 5 107914424 missense probably damaging 1.00
R4446:Fam69a UTSW 5 107924634 missense probably damaging 1.00
R4654:Fam69a UTSW 5 107910116 splice site probably null
R4979:Fam69a UTSW 5 107909534 nonsense probably null
R5405:Fam69a UTSW 5 107909961 missense probably benign 0.00
R5482:Fam69a UTSW 5 107909663 missense probably damaging 1.00
R6397:Fam69a UTSW 5 107911638 nonsense probably null
R7006:Fam69a UTSW 5 107910161 missense probably benign 0.01
R7465:Fam69a UTSW 5 107909684 missense probably damaging 1.00
R8004:Fam69a UTSW 5 107909666 missense probably damaging 1.00
X0013:Fam69a UTSW 5 107909847 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACATCTTGGCCCTACACCTG -3'
(R):5'- TGTAGAACTAGCTGTGACCTGAG -3'

Sequencing Primer
(F):5'- ACCTGCCATTATTGTTACAACATGC -3'
(R):5'- CTAGCTGTGACCTGAGTACAATG -3'
Posted On2014-10-01