Incidental Mutation 'R2169:Rab19'
ID235662
Institutional Source Beutler Lab
Gene Symbol Rab19
Ensembl Gene ENSMUSG00000029923
Gene NameRAB19, member RAS oncogene family
Synonyms
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39381175-39390380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39384041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 41 (V41G)
Ref Sequence ENSEMBL: ENSMUSP00000031986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031986]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031986
AA Change: V41G

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031986
Gene: ENSMUSG00000029923
AA Change: V41G

DomainStartEndE-ValueType
RAB 18 182 3.39e-99 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Rab19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rab19 APN 6 39388198 splice site probably benign
IGL02188:Rab19 APN 6 39384034 missense probably benign 0.10
IGL02452:Rab19 APN 6 39389798 missense probably benign
IGL03027:Rab19 APN 6 39383993 missense probably damaging 1.00
R0009:Rab19 UTSW 6 39389687 missense probably damaging 1.00
R0312:Rab19 UTSW 6 39384089 missense probably benign 0.02
R0726:Rab19 UTSW 6 39383959 missense probably benign 0.00
R1727:Rab19 UTSW 6 39388161 nonsense probably null
R1954:Rab19 UTSW 6 39384082 missense probably benign 0.06
R3796:Rab19 UTSW 6 39384041 missense probably benign 0.01
R4465:Rab19 UTSW 6 39388126 missense probably damaging 1.00
R5977:Rab19 UTSW 6 39383926 missense probably benign 0.07
R6619:Rab19 UTSW 6 39388126 missense probably damaging 0.99
R7489:Rab19 UTSW 6 39388105 missense probably benign 0.09
R8385:Rab19 UTSW 6 39383958 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAATCTCAGCCCTGGATCC -3'
(R):5'- GACTGCAGAAATTATGACCTTTAGG -3'

Sequencing Primer
(F):5'- CCTGGTAGGTGCTTCTTAGAAAAC -3'
(R):5'- GACTCTGGCCAACTAAAG -3'
Posted On2014-10-01