Mutagenetix > Incidental Mutation

Incidental Mutation 'R2169:Arhgef5'

235663

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

040172-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2169 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43274420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 702 (M702L)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: M702L

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: M702L

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,485,813	T606A	probably benign	Het
Adtrp	T	A	13: 41,767,429	S221C	possibly damaging	Het
Ap1g2	T	A	14: 55,099,340		probably null	Het
Axdnd1	A	G	1: 156,418,309	V34A	probably damaging	Het
Ccdc154	T	A	17: 25,170,923	V509E	probably damaging	Het
Cttnbp2	C	T	6: 18,426,097	D761N	probably benign	Het
Ddx18	A	T	1: 121,558,409		probably null	Het
Fam241b	A	T	10: 62,109,966	I4N	probably damaging	Het
Fam69a	A	T	5: 107,909,459	L411*	probably null	Het
Gm5800	T	C	14: 51,713,678	K155E	possibly damaging	Het
Hemgn	T	A	4: 46,396,417	H273L	possibly damaging	Het
Hsp90aa1	A	G	12: 110,692,734	V543A	probably damaging	Het
Hspa1l	A	G	17: 34,977,323	K113E	probably benign	Het
Hspb2	A	G	9: 50,751,715	I38T	probably damaging	Het
Htt	A	T	5: 34,877,475	E2021D	probably benign	Het
Lrpprc	C	T	17: 84,770,077	R394Q	probably benign	Het
Lrrc8b	T	C	5: 105,481,887	Y700H	probably damaging	Het
Mefv	A	G	16: 3,710,888	V593A	probably benign	Het
Mrgprh	C	T	17: 12,876,969	T32M	probably benign	Het
Mrpl18	A	G	17: 12,913,768		probably null	Het
Muc1	A	G	3: 89,231,596	E504G	probably damaging	Het
Ndufa13	G	A	8: 69,894,519	A77V	probably damaging	Het
Olfr952	A	G	9: 39,426,358	F238L	possibly damaging	Het
Pgbd5	T	A	8: 124,384,624		probably null	Het
Pgm5	T	A	19: 24,834,815	I118F	probably damaging	Het
Phyhip	T	C	14: 70,467,132	F264L	possibly damaging	Het
Polr3e	C	T	7: 120,932,137	R176W	probably damaging	Het
Prkacb	C	T	3: 146,746,683		probably null	Het
Rab19	T	G	6: 39,384,041	V41G	possibly damaging	Het
Rapgef5	A	G	12: 117,715,395	Y234C	probably benign	Het
Slc26a5	T	C	5: 21,813,865	T659A	probably damaging	Het
Slc6a2	G	A	8: 92,994,101	V449I	probably benign	Het
Stab2	A	G	10: 86,887,862	S1490P	probably damaging	Het
Tln1	T	C	4: 43,548,005	T713A	probably damaging	Het
Tmc6	A	T	11: 117,769,106	L732Q	probably damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn1r203	A	T	13: 22,524,735	K229*	probably null	Het
Xylt1	G	A	7: 117,667,437	G893R	probably damaging	Het
Ythdf1	A	T	2: 180,912,114	S69T	probably damaging	Het
Zfp114	C	T	7: 24,181,084	T285I	probably benign	Het
Zfp458	T	C	13: 67,257,049	E439G	probably damaging	Het
Zfp65	G	A	13: 67,710,380	T55I	probably damaging	Het
Zmym1	C	T	4: 127,054,203		probably null	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCAGAGGCCTCCTAAACCAG -3'
(R):5'- CCTTTAGAAGATCTATGGAGCCC -3'

Sequencing Primer
(F):5'- TATGGCTCTCTGACCCCAAGAAG -3'
(R):5'- ATCTATGGAGCCCTGAACTTAGG -3'

Posted On

2014-10-01