Incidental Mutation 'R2169:Zfp114'
ID235664
Institutional Source Beutler Lab
Gene Symbol Zfp114
Ensembl Gene ENSMUSG00000068962
Gene Namezinc finger protein 114
Synonyms
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24175060-24183188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24181084 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 285 (T285I)
Ref Sequence ENSEMBL: ENSMUSP00000146241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086010] [ENSMUST00000205309] [ENSMUST00000206547]
Predicted Effect probably benign
Transcript: ENSMUST00000086010
AA Change: T286I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083173
Gene: ENSMUSG00000068962
AA Change: T286I

DomainStartEndE-ValueType
KRAB 8 68 1.38e-17 SMART
low complexity region 158 168 N/A INTRINSIC
ZnF_C2H2 306 328 6.57e-1 SMART
ZnF_C2H2 334 356 1.95e-3 SMART
ZnF_C2H2 362 384 2.36e-2 SMART
ZnF_C2H2 390 412 3.16e-3 SMART
ZnF_C2H2 418 440 2.84e-5 SMART
ZnF_C2H2 446 468 4.87e-4 SMART
ZnF_C2H2 474 496 2.24e-3 SMART
ZnF_C2H2 502 524 7.37e-4 SMART
ZnF_C2H2 530 552 1.6e-4 SMART
ZnF_C2H2 558 580 2.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205309
AA Change: T285I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000206547
AA Change: T285I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Zfp114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03241:Zfp114 APN 7 24181012 missense probably benign 0.14
R0139:Zfp114 UTSW 7 24181260 missense possibly damaging 0.69
R1443:Zfp114 UTSW 7 24177769 missense probably damaging 1.00
R1793:Zfp114 UTSW 7 24177739 splice site probably null
R3928:Zfp114 UTSW 7 24181042 missense possibly damaging 0.93
R4915:Zfp114 UTSW 7 24177865 missense probably damaging 1.00
R6468:Zfp114 UTSW 7 24177781 missense possibly damaging 0.94
R7102:Zfp114 UTSW 7 24180658 missense possibly damaging 0.84
R7480:Zfp114 UTSW 7 24181882 missense probably damaging 1.00
R7847:Zfp114 UTSW 7 24181035 missense possibly damaging 0.67
X0026:Zfp114 UTSW 7 24180405 missense possibly damaging 0.92
X0061:Zfp114 UTSW 7 24180460 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTACCAATGCAGCAAGGGC -3'
(R):5'- GATATGAAGTCCGACTGAAGCCC -3'

Sequencing Primer
(F):5'- CAGCAAGGGCCAAGAAGC -3'
(R):5'- GTGACAACTTTGTGAAGCCC -3'
Posted On2014-10-01