Incidental Mutation 'R2169:Ndufa13'
ID235667
Institutional Source Beutler Lab
Gene Symbol Ndufa13
Ensembl Gene ENSMUSG00000036199
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13
SynonymsCDA016, 2700054G14Rik, GRIM-19, Grim19, CGI-39
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69894180-69902558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69894519 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 77 (A77V)
Ref Sequence ENSEMBL: ENSMUSP00000105796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110167] [ENSMUST00000110167] [ENSMUST00000152938] [ENSMUST00000180068]
Predicted Effect probably damaging
Transcript: ENSMUST00000110167
AA Change: A77V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105796
Gene: ENSMUSG00000036199
AA Change: A77V

DomainStartEndE-ValueType
Pfam:GRIM-19 5 129 9.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110167
AA Change: A77V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105796
Gene: ENSMUSG00000036199
AA Change: A77V

DomainStartEndE-ValueType
Pfam:GRIM-19 5 129 9.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152938
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain. The protein is required for complex I assembly and electron transfer activity. The protein binds the signal transducers and activators of transcription 3 (STAT3) transcription factor, and can function as a tumor suppressor. The human protein purified from mitochondria migrates at approximately 16 kDa. Transcripts originating from an upstream promoter and capable of expressing a protein with a longer N-terminus have been found, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, failed gastrulation, absent organogenesis, small and abnormal inner cell mass and trophoblast, and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Ndufa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Ndufa13 APN 8 69894419 intron probably benign
R3849:Ndufa13 UTSW 8 69901610 missense probably damaging 1.00
R5026:Ndufa13 UTSW 8 69895270 nonsense probably null
R8024:Ndufa13 UTSW 8 69894537 missense probably damaging 1.00
X0013:Ndufa13 UTSW 8 69895287 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCATACATCTCGCCAATGAGGG -3'
(R):5'- AACTCAGGTGGCCAGCATTG -3'

Sequencing Primer
(F):5'- ACCCATCGTGTGGTATGGAACAC -3'
(R):5'- AGCATTGGCCCCAGCTTC -3'
Posted On2014-10-01