Incidental Mutation 'R2169:Ndufa13'
ID 235667
Institutional Source Beutler Lab
Gene Symbol Ndufa13
Ensembl Gene ENSMUSG00000036199
Gene Name NADH:ubiquinone oxidoreductase subunit A13
Synonyms CGI-39, 2700054G14Rik, GRIM-19, Grim19, CDA016
MMRRC Submission 040172-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2169 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70346830-70355208 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70347169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 77 (A77V)
Ref Sequence ENSEMBL: ENSMUSP00000105796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110167] [ENSMUST00000110167] [ENSMUST00000152938] [ENSMUST00000180068]
AlphaFold Q9ERS2
Predicted Effect probably damaging
Transcript: ENSMUST00000110167
AA Change: A77V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105796
Gene: ENSMUSG00000036199
AA Change: A77V

DomainStartEndE-ValueType
Pfam:GRIM-19 5 129 9.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110167
AA Change: A77V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105796
Gene: ENSMUSG00000036199
AA Change: A77V

DomainStartEndE-ValueType
Pfam:GRIM-19 5 129 9.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152938
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain. The protein is required for complex I assembly and electron transfer activity. The protein binds the signal transducers and activators of transcription 3 (STAT3) transcription factor, and can function as a tumor suppressor. The human protein purified from mitochondria migrates at approximately 16 kDa. Transcripts originating from an upstream promoter and capable of expressing a protein with a longer N-terminus have been found, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, failed gastrulation, absent organogenesis, small and abnormal inner cell mass and trophoblast, and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,622,349 (GRCm39) T606A probably benign Het
Adtrp T A 13: 41,920,905 (GRCm39) S221C possibly damaging Het
Ap1g2 T A 14: 55,336,797 (GRCm39) probably null Het
Arhgef5 A T 6: 43,251,354 (GRCm39) M702L probably benign Het
Axdnd1 A G 1: 156,245,879 (GRCm39) V34A probably damaging Het
Ccdc154 T A 17: 25,389,897 (GRCm39) V509E probably damaging Het
Cttnbp2 C T 6: 18,426,096 (GRCm39) D761N probably benign Het
Ddx18 A T 1: 121,486,138 (GRCm39) probably null Het
Dipk1a A T 5: 108,057,325 (GRCm39) L411* probably null Het
Fam241b A T 10: 61,945,745 (GRCm39) I4N probably damaging Het
Gm5800 T C 14: 51,951,135 (GRCm39) K155E possibly damaging Het
Hemgn T A 4: 46,396,417 (GRCm39) H273L possibly damaging Het
Hsp90aa1 A G 12: 110,659,168 (GRCm39) V543A probably damaging Het
Hspa1l A G 17: 35,196,299 (GRCm39) K113E probably benign Het
Hspb2 A G 9: 50,663,015 (GRCm39) I38T probably damaging Het
Htt A T 5: 35,034,819 (GRCm39) E2021D probably benign Het
Lrpprc C T 17: 85,077,505 (GRCm39) R394Q probably benign Het
Lrrc8b T C 5: 105,629,753 (GRCm39) Y700H probably damaging Het
Mefv A G 16: 3,528,752 (GRCm39) V593A probably benign Het
Mrgprh C T 17: 13,095,856 (GRCm39) T32M probably benign Het
Mrpl18 A G 17: 13,132,655 (GRCm39) probably null Het
Muc1 A G 3: 89,138,903 (GRCm39) E504G probably damaging Het
Or8g33 A G 9: 39,337,654 (GRCm39) F238L possibly damaging Het
Pgbd5 T A 8: 125,111,363 (GRCm39) probably null Het
Pgm5 T A 19: 24,812,179 (GRCm39) I118F probably damaging Het
Phyhip T C 14: 70,704,572 (GRCm39) F264L possibly damaging Het
Polr3e C T 7: 120,531,360 (GRCm39) R176W probably damaging Het
Prkacb C T 3: 146,452,438 (GRCm39) probably null Het
Rab19 T G 6: 39,360,975 (GRCm39) V41G possibly damaging Het
Rapgef5 A G 12: 117,679,130 (GRCm39) Y234C probably benign Het
Slc26a5 T C 5: 22,018,863 (GRCm39) T659A probably damaging Het
Slc6a2 G A 8: 93,720,729 (GRCm39) V449I probably benign Het
Stab2 A G 10: 86,723,726 (GRCm39) S1490P probably damaging Het
Tln1 T C 4: 43,548,005 (GRCm39) T713A probably damaging Het
Tmc6 A T 11: 117,659,932 (GRCm39) L732Q probably damaging Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Vmn1r203 A T 13: 22,708,905 (GRCm39) K229* probably null Het
Xylt1 G A 7: 117,266,660 (GRCm39) G893R probably damaging Het
Ythdf1 A T 2: 180,553,907 (GRCm39) S69T probably damaging Het
Zfp114 C T 7: 23,880,509 (GRCm39) T285I probably benign Het
Zfp458 T C 13: 67,405,113 (GRCm39) E439G probably damaging Het
Zfp65 G A 13: 67,858,499 (GRCm39) T55I probably damaging Het
Zmym1 C T 4: 126,947,996 (GRCm39) probably null Het
Other mutations in Ndufa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Ndufa13 APN 8 70,347,069 (GRCm39) intron probably benign
R3849:Ndufa13 UTSW 8 70,354,260 (GRCm39) missense probably damaging 1.00
R5026:Ndufa13 UTSW 8 70,347,920 (GRCm39) nonsense probably null
R8024:Ndufa13 UTSW 8 70,347,187 (GRCm39) missense probably damaging 1.00
X0013:Ndufa13 UTSW 8 70,347,937 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCATACATCTCGCCAATGAGGG -3'
(R):5'- AACTCAGGTGGCCAGCATTG -3'

Sequencing Primer
(F):5'- ACCCATCGTGTGGTATGGAACAC -3'
(R):5'- AGCATTGGCCCCAGCTTC -3'
Posted On 2014-10-01