Incidental Mutation 'R2169:Slc6a2'
ID235668
Institutional Source Beutler Lab
Gene Symbol Slc6a2
Ensembl Gene ENSMUSG00000055368
Gene Namesolute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonymsnorepinephrine transporter, NE transporter, Slc6a5, NET
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92960079-93001667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92994101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 449 (V449I)
Ref Sequence ENSEMBL: ENSMUSP00000129869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072939] [ENSMUST00000165470]
Predicted Effect probably benign
Transcript: ENSMUST00000072939
AA Change: V449I

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072709
Gene: ENSMUSG00000055368
AA Change: V449I

DomainStartEndE-ValueType
Pfam:SNF 56 580 4.7e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165470
AA Change: V449I

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129869
Gene: ENSMUSG00000055368
AA Change: V449I

DomainStartEndE-ValueType
Pfam:SNF 56 580 4.7e-242 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium:neurotransmitter symporter family. This member is a multi-pass membrane protein, which is responsible for reuptake of norepinephrine into presynaptic nerve terminals and is a regulator of norepinephrine homeostasis. Mutations in this gene cause orthostatic intolerance, a syndrome characterized by lightheadedness, fatigue, altered mentation and syncope. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Norepinephrine homeostasis is abnormal in homozygous mutant mice. In addition to displaying altered behavior, mutant mice are hypersensitive to psychostimulants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Slc6a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Slc6a2 APN 8 92997057 missense possibly damaging 0.57
IGL00864:Slc6a2 APN 8 92995994 missense probably benign 0.02
IGL00910:Slc6a2 APN 8 92996100 missense probably damaging 1.00
IGL01531:Slc6a2 APN 8 92995682 missense probably damaging 1.00
IGL02209:Slc6a2 APN 8 92994060 missense probably benign 0.41
IGL02962:Slc6a2 APN 8 92972762 nonsense probably null
IGL03391:Slc6a2 APN 8 92961452 missense probably damaging 1.00
H8786:Slc6a2 UTSW 8 92994640 missense probably benign 0.03
R0308:Slc6a2 UTSW 8 92961360 missense possibly damaging 0.83
R0632:Slc6a2 UTSW 8 92992801 splice site probably benign
R0765:Slc6a2 UTSW 8 92989031 missense probably damaging 0.96
R1250:Slc6a2 UTSW 8 92992863 missense probably benign 0.12
R1444:Slc6a2 UTSW 8 92971254 missense probably damaging 0.99
R1637:Slc6a2 UTSW 8 92981990 missense probably benign 0.00
R1699:Slc6a2 UTSW 8 92972812 missense possibly damaging 0.95
R1760:Slc6a2 UTSW 8 92961218 splice site probably benign
R2046:Slc6a2 UTSW 8 92972926 nonsense probably null
R2182:Slc6a2 UTSW 8 92961248 start codon destroyed probably null 0.00
R3107:Slc6a2 UTSW 8 92961278 missense probably benign 0.26
R3880:Slc6a2 UTSW 8 92990218 missense probably damaging 1.00
R5092:Slc6a2 UTSW 8 92994719 missense possibly damaging 0.87
R5684:Slc6a2 UTSW 8 92989053 missense probably damaging 1.00
R6218:Slc6a2 UTSW 8 92981981 missense probably benign
R6932:Slc6a2 UTSW 8 92996025 missense probably benign 0.00
R7201:Slc6a2 UTSW 8 92995672 missense probably damaging 1.00
R7910:Slc6a2 UTSW 8 92994138 missense possibly damaging 0.53
R8320:Slc6a2 UTSW 8 92992848 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GTCTGTTATTTTCCGGAAAGCC -3'
(R):5'- ACGGGATCTGCTGTCTTATCG -3'

Sequencing Primer
(F):5'- TCCGGAAAGCCTTATGTAACTG -3'
(R):5'- TAACAGAGCCGTTGTGCTCAG -3'
Posted On2014-10-01