Incidental Mutation 'R2169:Hspb2'
ID235671
Institutional Source Beutler Lab
Gene Symbol Hspb2
Ensembl Gene ENSMUSG00000038086
Gene Nameheat shock protein 2
SynonymsHSP27, MKBP, 2810021G24Rik, 27kDa
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R2169 (G1)
Quality Score133
Status Not validated
Chromosome9
Chromosomal Location50751078-50752354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50751715 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 38 (I38T)
Ref Sequence ENSEMBL: ENSMUSP00000042374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034562] [ENSMUST00000042790] [ENSMUST00000214609] [ENSMUST00000214962] [ENSMUST00000216755] [ENSMUST00000217159] [ENSMUST00000217475]
Predicted Effect probably benign
Transcript: ENSMUST00000034562
SMART Domains Protein: ENSMUSP00000034562
Gene: ENSMUSG00000032060

DomainStartEndE-ValueType
Pfam:Crystallin 1 56 7.3e-32 PFAM
Pfam:HSP20 67 162 2.1e-27 PFAM
low complexity region 166 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042790
AA Change: I38T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042374
Gene: ENSMUSG00000038086
AA Change: I38T

DomainStartEndE-ValueType
Pfam:Crystallin 14 55 1.6e-8 PFAM
Pfam:HSP20 66 163 5.7e-19 PFAM
low complexity region 166 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214609
Predicted Effect probably benign
Transcript: ENSMUST00000214962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216393
Predicted Effect probably benign
Transcript: ENSMUST00000216755
Predicted Effect probably benign
Transcript: ENSMUST00000217159
Predicted Effect probably benign
Transcript: ENSMUST00000217475
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The protein is expressed preferentially in the heart and skeletal muscle. This protein regulates Myotonic Dystrophy Protein Kinase, which plays an important role in maintenance of muscle structure and function. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the heart exhibit reduced state 3 mitochondrial respiration and ATP production following transverse aortic constriction despite normal cardiac hypertrophic response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Hspb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0573:Hspb2 UTSW 9 50751364 missense probably benign 0.43
R2075:Hspb2 UTSW 9 50751346 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGGTTATCCACAGTCCTCACC -3'
(R):5'- CAGAGTACCTTCTGATTTCGCG -3'

Sequencing Primer
(F):5'- CGTCACCTCATCTGGGGTAAAGTG -3'
(R):5'- AGCTCGCTTCCTCCATGG -3'
Posted On2014-10-01