Incidental Mutation 'R2169:Vmn1r203'
ID235679
Institutional Source Beutler Lab
Gene Symbol Vmn1r203
Ensembl Gene ENSMUSG00000069289
Gene Namevomeronasal 1 receptor 203
SynonymsV1rh11
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22518114-22531992 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22524735 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 229 (K229*)
Ref Sequence ENSEMBL: ENSMUSP00000154399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091729] [ENSMUST00000227520] [ENSMUST00000228889]
Predicted Effect probably null
Transcript: ENSMUST00000091729
AA Change: K229*
SMART Domains Protein: ENSMUSP00000089322
Gene: ENSMUSG00000069289
AA Change: K229*

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
Pfam:V1R 43 304 5.8e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137651
Predicted Effect probably null
Transcript: ENSMUST00000227520
AA Change: K229*
Predicted Effect probably null
Transcript: ENSMUST00000228889
AA Change: K229*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Vmn1r203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Vmn1r203 APN 13 22524777 missense probably damaging 1.00
IGL01527:Vmn1r203 APN 13 22524277 missense possibly damaging 0.89
IGL01808:Vmn1r203 APN 13 22524547 missense probably benign 0.02
IGL01887:Vmn1r203 APN 13 22524876 missense probably benign 0.00
IGL02340:Vmn1r203 APN 13 22524827 nonsense probably null
IGL02543:Vmn1r203 APN 13 22524904 missense probably damaging 1.00
IGL02684:Vmn1r203 APN 13 22524369 missense possibly damaging 0.95
BB005:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
BB015:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
PIT4519001:Vmn1r203 UTSW 13 22524595 missense probably benign 0.01
R0544:Vmn1r203 UTSW 13 22524273 missense possibly damaging 0.94
R1365:Vmn1r203 UTSW 13 22524586 missense probably benign 0.00
R1396:Vmn1r203 UTSW 13 22524508 missense probably benign 0.01
R1794:Vmn1r203 UTSW 13 22524351 missense probably damaging 1.00
R2010:Vmn1r203 UTSW 13 22524447 missense possibly damaging 0.56
R2333:Vmn1r203 UTSW 13 22524943 missense probably damaging 1.00
R2418:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R2419:Vmn1r203 UTSW 13 22524834 missense possibly damaging 0.57
R4322:Vmn1r203 UTSW 13 22524238 missense probably damaging 1.00
R4460:Vmn1r203 UTSW 13 22524682 missense probably damaging 0.98
R4686:Vmn1r203 UTSW 13 22524358 missense probably damaging 1.00
R5526:Vmn1r203 UTSW 13 22524103 missense probably benign 0.01
R6240:Vmn1r203 UTSW 13 22524729 missense possibly damaging 0.89
R6607:Vmn1r203 UTSW 13 22524721 missense probably benign 0.23
R7575:Vmn1r203 UTSW 13 22524418 missense probably benign 0.12
R7928:Vmn1r203 UTSW 13 22524535 missense probably benign 0.01
R8375:Vmn1r203 UTSW 13 22524984 makesense probably null
Z1177:Vmn1r203 UTSW 13 22524409 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGAACCTAATCCATTCCATTAGAAG -3'
(R):5'- GTTGCATAACCAAGGGCCAG -3'

Sequencing Primer
(F):5'- TCCATTCCATTAGAAGCACAAGTCTG -3'
(R):5'- GGGCCAGAAAATTTCGAGTGTTTAC -3'
Posted On2014-10-01