Incidental Mutation 'R2169:Zfp65'
ID235682
Institutional Source Beutler Lab
Gene Symbol Zfp65
Ensembl Gene ENSMUSG00000071281
Gene Namezinc finger protein 65
SynonymsZfp71-rs1, KRAB5
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67705309-67729173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67710380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 55 (T55I)
Ref Sequence ENSEMBL: ENSMUSP00000153058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073157] [ENSMUST00000127979] [ENSMUST00000130891] [ENSMUST00000223829]
Predicted Effect probably damaging
Transcript: ENSMUST00000073157
AA Change: T55I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072900
Gene: ENSMUSG00000071281
AA Change: T55I

DomainStartEndE-ValueType
KRAB 5 65 9.17e-32 SMART
ZnF_C2H2 81 101 1.05e1 SMART
ZnF_C2H2 109 131 8.4e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 5.99e-4 SMART
ZnF_C2H2 193 215 1.56e-2 SMART
ZnF_C2H2 221 243 1.95e-3 SMART
ZnF_C2H2 249 271 4.79e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 8.22e-2 SMART
ZnF_C2H2 333 355 5.9e-3 SMART
ZnF_C2H2 361 383 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127979
AA Change: T52I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117218
Gene: ENSMUSG00000071281
AA Change: T52I

DomainStartEndE-ValueType
KRAB 2 62 9.17e-32 SMART
ZnF_C2H2 78 98 1.05e1 SMART
ZnF_C2H2 106 128 8.4e1 SMART
ZnF_C2H2 134 156 3.58e-2 SMART
ZnF_C2H2 162 184 5.99e-4 SMART
ZnF_C2H2 190 212 1.56e-2 SMART
ZnF_C2H2 218 240 1.95e-3 SMART
ZnF_C2H2 246 268 4.79e-3 SMART
ZnF_C2H2 274 296 3.63e-3 SMART
ZnF_C2H2 302 324 8.22e-2 SMART
ZnF_C2H2 330 352 5.9e-3 SMART
ZnF_C2H2 358 380 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130891
AA Change: T65I

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123380
Gene: ENSMUSG00000071281
AA Change: T65I

DomainStartEndE-ValueType
KRAB 15 75 9.17e-32 SMART
ZnF_C2H2 91 111 1.05e1 SMART
ZnF_C2H2 119 141 8.4e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 5.99e-4 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 231 253 1.95e-3 SMART
ZnF_C2H2 259 281 4.79e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223829
AA Change: T55I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Zfp65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Zfp65 APN 13 67708185 missense possibly damaging 0.92
IGL02563:Zfp65 APN 13 67708065 missense possibly damaging 0.88
R2142:Zfp65 UTSW 13 67708192 missense probably damaging 1.00
R4702:Zfp65 UTSW 13 67724222 start codon destroyed probably null 0.98
R4770:Zfp65 UTSW 13 67708358 missense probably damaging 1.00
R4836:Zfp65 UTSW 13 67708875 missense probably benign 0.15
R4943:Zfp65 UTSW 13 67710980 missense probably damaging 0.99
R5229:Zfp65 UTSW 13 67708810 missense probably benign 0.02
R6178:Zfp65 UTSW 13 67710318 missense probably benign 0.21
R6786:Zfp65 UTSW 13 67708011 missense probably damaging 1.00
R6991:Zfp65 UTSW 13 67708521 missense probably damaging 0.97
R7896:Zfp65 UTSW 13 67729055 splice site probably null
R8376:Zfp65 UTSW 13 67708918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACACAAGTTAATCTCATAGTGG -3'
(R):5'- TGTGCCCATCAGAAAACATGTG -3'

Sequencing Primer
(F):5'- CAAAGCTTATGAGATTCAAAGCATCC -3'
(R):5'- GCCCATCAGAAAACATGTGAAAAATG -3'
Posted On2014-10-01