Incidental Mutation 'R2169:Ap1g2'
ID235685
Institutional Source Beutler Lab
Gene Symbol Ap1g2
Ensembl Gene ENSMUSG00000040701
Gene Nameadaptor protein complex AP-1, gamma 2 subunit
Synonymsgamma 2-adaptin, Adtg2
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55098575-55106593 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 55099340 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036041] [ENSMUST00000050575] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000151314] [ENSMUST00000170285] [ENSMUST00000170285] [ENSMUST00000185121] [ENSMUST00000183822]
Predicted Effect probably null
Transcript: ENSMUST00000036041
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050575
SMART Domains Protein: ENSMUSP00000056026
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
CYTH 5 200 1.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139536
Predicted Effect probably benign
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153702
Predicted Effect probably null
Transcript: ENSMUST00000170285
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170285
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Ap1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1g2 APN 14 55105114 missense probably benign 0.01
IGL02421:Ap1g2 APN 14 55102402 missense probably damaging 1.00
IGL02633:Ap1g2 APN 14 55100647 splice site probably null
IGL02967:Ap1g2 APN 14 55105022 splice site probably benign
IGL03030:Ap1g2 APN 14 55106047 missense probably damaging 1.00
IGL03087:Ap1g2 APN 14 55103036 missense probably damaging 0.99
IGL03261:Ap1g2 APN 14 55100530 missense probably benign 0.00
IGL03308:Ap1g2 APN 14 55104876 missense probably benign 0.44
R0284:Ap1g2 UTSW 14 55101692 splice site probably benign
R0614:Ap1g2 UTSW 14 55099773 missense probably benign 0.00
R0762:Ap1g2 UTSW 14 55100411 splice site probably benign
R1561:Ap1g2 UTSW 14 55104887 missense probably damaging 1.00
R1889:Ap1g2 UTSW 14 55101429 missense probably damaging 1.00
R1938:Ap1g2 UTSW 14 55099772 missense possibly damaging 0.80
R1997:Ap1g2 UTSW 14 55102378 missense probably benign 0.00
R3157:Ap1g2 UTSW 14 55099274 missense probably damaging 0.96
R3820:Ap1g2 UTSW 14 55100573 splice site probably benign
R3850:Ap1g2 UTSW 14 55104906 missense probably benign 0.03
R4750:Ap1g2 UTSW 14 55104365 missense probably damaging 1.00
R4909:Ap1g2 UTSW 14 55105026 critical splice donor site probably null
R5305:Ap1g2 UTSW 14 55099076 missense probably benign
R5880:Ap1g2 UTSW 14 55102700 missense probably damaging 1.00
R6243:Ap1g2 UTSW 14 55099073 missense probably benign
R6964:Ap1g2 UTSW 14 55099265 missense possibly damaging 0.85
R7039:Ap1g2 UTSW 14 55102654 nonsense probably null
R7180:Ap1g2 UTSW 14 55104451 missense probably damaging 1.00
R7563:Ap1g2 UTSW 14 55099749 missense probably damaging 1.00
R7818:Ap1g2 UTSW 14 55099724 missense probably benign 0.44
R7854:Ap1g2 UTSW 14 55105933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCTCCTGTACTGGCTGG -3'
(R):5'- TCAGAGGTAGCCAGGGAATTTC -3'

Sequencing Primer
(F):5'- CGCAGCTTAAGTCGCAAAG -3'
(R):5'- GTAGCCAGGGAATTTCAGGAG -3'
Posted On2014-10-01