Incidental Mutation 'R2169:Phyhip'
ID235686
Institutional Source Beutler Lab
Gene Symbol Phyhip
Ensembl Gene ENSMUSG00000003469
Gene Namephytanoyl-CoA hydroxylase interacting protein
SynonymsPAHX-AP1, C630010D02Rik, PAHX-AP#1
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70457476-70468832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70467132 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 264 (F264L)
Ref Sequence ENSEMBL: ENSMUSP00000003561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003561] [ENSMUST00000159180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003561
AA Change: F264L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003561
Gene: ENSMUSG00000003469
AA Change: F264L

DomainStartEndE-ValueType
FN3 4 97 1.75e0 SMART
Blast:FN3 145 217 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159180
SMART Domains Protein: ENSMUSP00000125254
Gene: ENSMUSG00000003469

DomainStartEndE-ValueType
Blast:FN3 4 88 7e-47 BLAST
SCOP:d1fnf_2 4 88 4e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Phyhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Phyhip APN 14 70463357 missense probably benign
IGL02742:Phyhip APN 14 70461927 splice site probably null
R0312:Phyhip UTSW 14 70466970 missense possibly damaging 0.92
R0322:Phyhip UTSW 14 70463396 missense possibly damaging 0.74
R0534:Phyhip UTSW 14 70461759 start codon destroyed possibly damaging 0.65
R1443:Phyhip UTSW 14 70467291 missense probably damaging 1.00
R1523:Phyhip UTSW 14 70461760 start codon destroyed probably null 0.96
R2209:Phyhip UTSW 14 70461894 missense probably damaging 1.00
R4888:Phyhip UTSW 14 70467325 missense probably damaging 0.99
R5366:Phyhip UTSW 14 70466855 missense probably benign 0.17
R5595:Phyhip UTSW 14 70466874 missense probably benign 0.04
R5756:Phyhip UTSW 14 70467092 missense probably damaging 1.00
R5837:Phyhip UTSW 14 70467010 missense probably damaging 0.99
R5852:Phyhip UTSW 14 70461929 splice site probably null
R6106:Phyhip UTSW 14 70461859 missense probably benign 0.28
R6159:Phyhip UTSW 14 70466854 missense possibly damaging 0.77
R6209:Phyhip UTSW 14 70463358 missense probably benign 0.26
R6246:Phyhip UTSW 14 70467055 missense probably damaging 1.00
R7134:Phyhip UTSW 14 70467199 missense probably benign 0.18
R7458:Phyhip UTSW 14 70461820 missense probably damaging 0.96
Z1177:Phyhip UTSW 14 70461862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCTGCAACACGGAGTTC -3'
(R):5'- GGATCTTTCTTGGCGTCAGC -3'

Sequencing Primer
(F):5'- CGGAGTTCAACACAGGCCAG -3'
(R):5'- TCAGCAGTGGACAGGCTCATG -3'
Posted On2014-10-01