Incidental Mutation 'R2169:Mefv'
ID235687
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene NameMediterranean fever
SynonymsTRIM20, marenostrin, pyrin, FMF
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3707218-3718097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3710888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 593 (V593A)
Ref Sequence ENSEMBL: ENSMUSP00000097795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
Predicted Effect probably benign
Transcript: ENSMUST00000023180
AA Change: V563A

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534
AA Change: V563A

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100222
AA Change: V593A

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534
AA Change: V593A

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229725
AA Change: V563A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3710960 missense probably benign 0.01
IGL00583:Mefv APN 16 3716072 nonsense probably null
IGL00963:Mefv APN 16 3715720 missense possibly damaging 0.83
IGL02185:Mefv APN 16 3715850 missense probably benign 0.09
IGL02500:Mefv APN 16 3713577 missense probably damaging 1.00
R0158:Mefv UTSW 16 3715456 missense possibly damaging 0.67
R1312:Mefv UTSW 16 3708534 splice site probably benign
R1793:Mefv UTSW 16 3708664 missense possibly damaging 0.53
R1956:Mefv UTSW 16 3717827 missense probably damaging 1.00
R2973:Mefv UTSW 16 3715694 nonsense probably null
R3723:Mefv UTSW 16 3708194 critical splice donor site probably null
R3724:Mefv UTSW 16 3708194 critical splice donor site probably null
R3953:Mefv UTSW 16 3715400 missense possibly damaging 0.60
R4276:Mefv UTSW 16 3715569 missense probably benign 0.41
R4650:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4651:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4652:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4670:Mefv UTSW 16 3708207 missense possibly damaging 0.67
R4781:Mefv UTSW 16 3715334 missense probably benign 0.00
R5593:Mefv UTSW 16 3715451 missense probably benign 0.00
R5834:Mefv UTSW 16 3716046 missense probably damaging 0.97
R5867:Mefv UTSW 16 3715933 missense probably damaging 1.00
R5954:Mefv UTSW 16 3715715 missense probably benign 0.09
R6056:Mefv UTSW 16 3708042 missense possibly damaging 0.73
R6260:Mefv UTSW 16 3713034 missense probably benign 0.03
R6409:Mefv UTSW 16 3710793 critical splice donor site probably null
R6511:Mefv UTSW 16 3715946 missense probably benign 0.00
R6666:Mefv UTSW 16 3707998 missense possibly damaging 0.88
R6952:Mefv UTSW 16 3710880 missense probably damaging 1.00
R7259:Mefv UTSW 16 3713053 missense probably damaging 1.00
R7410:Mefv UTSW 16 3715681 missense probably damaging 1.00
R7444:Mefv UTSW 16 3715522 missense probably benign 0.21
X0064:Mefv UTSW 16 3710841 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTAATGGCCATGCTTCCTGGC -3'
(R):5'- ATGATCTTGGAGGGCATTCC -3'

Sequencing Primer
(F):5'- CCATGCTTCCTGGCTTGGG -3'
(R):5'- GGGCATTCCTAGATACATACTTCCAG -3'
Posted On2014-10-01