Incidental Mutation 'R2169:Mrpl18'
ID235689
Institutional Source Beutler Lab
Gene Symbol Mrpl18
Ensembl Gene ENSMUSG00000057388
Gene Namemitochondrial ribosomal protein L18
SynonymsMRP-L18, 1010001C05Rik, HSPC071
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12911349-12916345 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12913768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079121] [ENSMUST00000089024] [ENSMUST00000143961] [ENSMUST00000151287] [ENSMUST00000163394]
Predicted Effect probably null
Transcript: ENSMUST00000079121
SMART Domains Protein: ENSMUSP00000078123
Gene: ENSMUSG00000057388

DomainStartEndE-ValueType
PDB:4CE4|S 1 180 1e-108 PDB
SCOP:d1jj2m_ 78 141 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089024
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133003
Predicted Effect probably benign
Transcript: ENSMUST00000143961
SMART Domains Protein: ENSMUSP00000116511
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 103 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147724
Predicted Effect probably benign
Transcript: ENSMUST00000151287
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162978
Predicted Effect probably benign
Transcript: ENSMUST00000163394
SMART Domains Protein: ENSMUSP00000129377
Gene: ENSMUSG00000073460

DomainStartEndE-ValueType
Pfam:CAF1 3 373 1e-75 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a protein component of the larger 39S subunit of mitochondrial ribosome. This protein may also aid in the import of nuclear-encoded 5S rRNA into mitochondria. Alternative splicing results in multiple transcript variants, most of which are not predicted to encode a protein. A pseudogene of this gene is found on chromosome 16. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Mrpl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Mrpl18 APN 17 12915806 missense possibly damaging 0.72
IGL01677:Mrpl18 APN 17 12911688 missense probably damaging 1.00
R5090:Mrpl18 UTSW 17 12913810 missense probably damaging 0.98
R7059:Mrpl18 UTSW 17 12913781 missense possibly damaging 0.70
R8154:Mrpl18 UTSW 17 12911721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACAACTGATCTTGTTCCCC -3'
(R):5'- TGTTTCAGCATCCACTCGAG -3'

Sequencing Primer
(F):5'- CTAGATGGAACTTCCTTGGTAGACC -3'
(R):5'- GTTTCAGCATCCACTCGAGAATGG -3'
Posted On2014-10-01