Incidental Mutation 'R2169:Ccdc154'
ID235690
Institutional Source Beutler Lab
Gene Symbol Ccdc154
Ensembl Gene ENSMUSG00000059562
Gene Namecoiled-coil domain containing 154
SynonymsLOC207209
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25162461-25171913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25170923 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 509 (V509E)
Ref Sequence ENSEMBL: ENSMUSP00000138191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073277] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178] [ENSMUST00000224277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073277
AA Change: V518E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562
AA Change: V518E

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182292
AA Change: V509E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562
AA Change: V509E

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182621
AA Change: V511E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562
AA Change: V511E

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224277
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Ccdc154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Ccdc154 APN 17 25167818 critical splice donor site probably null
IGL02427:Ccdc154 APN 17 25171757 critical splice acceptor site probably null
IGL03188:Ccdc154 APN 17 25164093 critical splice acceptor site probably null
R0256:Ccdc154 UTSW 17 25170632 missense probably benign 0.19
R0328:Ccdc154 UTSW 17 25171805 missense probably benign 0.25
R0583:Ccdc154 UTSW 17 25168424 missense possibly damaging 0.60
R0671:Ccdc154 UTSW 17 25167285 splice site probably benign
R0898:Ccdc154 UTSW 17 25164081 splice site probably benign
R1758:Ccdc154 UTSW 17 25163182 missense probably damaging 0.99
R2165:Ccdc154 UTSW 17 25170890 missense probably damaging 1.00
R4810:Ccdc154 UTSW 17 25163498 missense probably damaging 1.00
R4853:Ccdc154 UTSW 17 25170967 missense probably damaging 1.00
R4959:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R4973:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R5040:Ccdc154 UTSW 17 25164592 missense probably benign 0.04
R5153:Ccdc154 UTSW 17 25168341 missense probably damaging 1.00
R5179:Ccdc154 UTSW 17 25171163 missense probably benign 0.43
R5709:Ccdc154 UTSW 17 25170144 missense probably damaging 1.00
R5852:Ccdc154 UTSW 17 25163209 missense probably benign
R5886:Ccdc154 UTSW 17 25171818 missense probably benign
R6191:Ccdc154 UTSW 17 25167971 missense probably damaging 1.00
R7101:Ccdc154 UTSW 17 25163468 missense probably benign 0.00
R7888:Ccdc154 UTSW 17 25164604 missense possibly damaging 0.94
R7896:Ccdc154 UTSW 17 25171826 missense probably benign 0.00
R8331:Ccdc154 UTSW 17 25167953 missense probably benign 0.29
R8334:Ccdc154 UTSW 17 25171607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTCGGAAGTACAGAAAC -3'
(R):5'- AATCACAGGCAGACATGGAC -3'

Sequencing Primer
(F):5'- CACCTCTGCCTGGATGGTTG -3'
(R):5'- CGGCTGACGTCCAAATGTAC -3'
Posted On2014-10-01