Incidental Mutation 'R2169:Hspa1l'
ID235692
Institutional Source Beutler Lab
Gene Symbol Hspa1l
Ensembl Gene ENSMUSG00000007033
Gene Nameheat shock protein 1-like
Synonyms70kDa, Msh5, Hsc70t
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34972703-34979285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34977323 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 113 (K113E)
Ref Sequence ENSEMBL: ENSMUSP00000007248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]
Predicted Effect probably benign
Transcript: ENSMUST00000007248
AA Change: K113E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: K113E

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007266
SMART Domains Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 41 108 8.91e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114011
SMART Domains Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 5 72 8.91e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172890
Predicted Effect probably benign
Transcript: ENSMUST00000173004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Hspa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Hspa1l APN 17 34977465 missense probably damaging 1.00
IGL01548:Hspa1l APN 17 34978391 missense probably damaging 0.98
IGL01860:Hspa1l APN 17 34978811 missense probably benign 0.00
IGL01959:Hspa1l APN 17 34977135 missense probably damaging 1.00
IGL02661:Hspa1l APN 17 34977275 missense probably benign
R0355:Hspa1l UTSW 17 34977410 missense probably benign
R0850:Hspa1l UTSW 17 34977623 missense probably benign 0.01
R1675:Hspa1l UTSW 17 34977443 missense probably damaging 1.00
R2148:Hspa1l UTSW 17 34977390 missense probably damaging 0.98
R2418:Hspa1l UTSW 17 34977188 missense probably benign 0.05
R4323:Hspa1l UTSW 17 34977856 nonsense probably null
R4924:Hspa1l UTSW 17 34977856 nonsense probably null
R4926:Hspa1l UTSW 17 34978223 missense possibly damaging 0.92
R5186:Hspa1l UTSW 17 34978469 missense probably damaging 0.97
R5653:Hspa1l UTSW 17 34977420 missense probably damaging 1.00
R5790:Hspa1l UTSW 17 34977240 missense probably benign 0.08
R6086:Hspa1l UTSW 17 34978155 missense possibly damaging 0.77
R6237:Hspa1l UTSW 17 34977452 nonsense probably null
R7229:Hspa1l UTSW 17 34977255 missense probably benign 0.05
Z1176:Hspa1l UTSW 17 34978492 missense possibly damaging 0.52
Z1177:Hspa1l UTSW 17 34978016 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACGGCAAGGTGGAGATCATC -3'
(R):5'- CACATTGAGTCCTGCGATGAC -3'

Sequencing Primer
(F):5'- TGGAGATCATCGCCAACG -3'
(R):5'- ATTGAGTCCTGCGATGACACCTG -3'
Posted On2014-10-01