Incidental Mutation 'R2169:Lrpprc'
ID235693
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Nameleucine-rich PPR-motif containing
Synonyms3110001K13Rik, Lrp130
MMRRC Submission 040172-MU
Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84705247-84790789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84770077 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 394 (R394Q)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
Predicted Effect probably benign
Transcript: ENSMUST00000112308
AA Change: R394Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: R394Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161928
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp458 T C 13: 67,257,049 E439G probably damaging Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 84750525 missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 84705412 utr 3 prime probably benign
IGL01380:Lrpprc APN 17 84722730 missense probably benign
IGL01560:Lrpprc APN 17 84708119 missense probably benign 0.07
IGL01582:Lrpprc APN 17 84754543 missense probably null 0.00
IGL01996:Lrpprc APN 17 84773270 missense probably benign
IGL02109:Lrpprc APN 17 84726570 nonsense probably null
IGL02163:Lrpprc APN 17 84753472 missense probably damaging 0.97
IGL02248:Lrpprc APN 17 84771467 missense probably damaging 0.99
IGL02503:Lrpprc APN 17 84726339 missense probably benign
IGL02545:Lrpprc APN 17 84775425 missense probably benign
IGL02570:Lrpprc APN 17 84750553 missense probably damaging 1.00
IGL02636:Lrpprc APN 17 84753104 unclassified probably benign
IGL02943:Lrpprc APN 17 84771450 missense probably benign 0.00
IGL03008:Lrpprc APN 17 84751247 missense probably benign 0.05
R6807_Lrpprc_629 UTSW 17 84749103 missense possibly damaging 0.93
P0023:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0302:Lrpprc UTSW 17 84740078 missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 84753112 critical splice donor site probably null
R0448:Lrpprc UTSW 17 84770894 missense probably benign 0.09
R1396:Lrpprc UTSW 17 84726303 missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 84740081 missense probably damaging 1.00
R2019:Lrpprc UTSW 17 84752331 missense possibly damaging 0.56
R2312:Lrpprc UTSW 17 84773258 missense probably damaging 0.96
R2319:Lrpprc UTSW 17 84726390 missense probably benign
R2568:Lrpprc UTSW 17 84726649 missense probably damaging 1.00
R3013:Lrpprc UTSW 17 84767069 missense probably benign 0.04
R3620:Lrpprc UTSW 17 84770024 missense probably benign 0.01
R3789:Lrpprc UTSW 17 84771528 missense probably benign 0.25
R3848:Lrpprc UTSW 17 84770927 missense probably benign 0.01
R3973:Lrpprc UTSW 17 84770841 critical splice donor site probably null
R4111:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R4164:Lrpprc UTSW 17 84731189 missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 84740542 critical splice donor site probably null
R4531:Lrpprc UTSW 17 84712787 missense probably benign 0.01
R4832:Lrpprc UTSW 17 84707156 missense probably benign 0.24
R4947:Lrpprc UTSW 17 84771538 missense probably benign 0.02
R5134:Lrpprc UTSW 17 84751256 missense probably benign 0.00
R5333:Lrpprc UTSW 17 84790393 missense probably benign 0.01
R5950:Lrpprc UTSW 17 84740170 missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 84712822 missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 84767024 missense probably benign
R6253:Lrpprc UTSW 17 84740637 missense probably benign 0.00
R6488:Lrpprc UTSW 17 84751353 missense probably damaging 1.00
R6807:Lrpprc UTSW 17 84749103 missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 84756283 missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 84722703 missense probably benign 0.42
R6955:Lrpprc UTSW 17 84776989 missense probably damaging 0.98
R7448:Lrpprc UTSW 17 84772139 missense probably damaging 0.99
R7727:Lrpprc UTSW 17 84776947 missense probably benign 0.00
R8003:Lrpprc UTSW 17 84752317 missense probably benign 0.01
R8178:Lrpprc UTSW 17 84772147 missense probably damaging 1.00
R8310:Lrpprc UTSW 17 84773096 missense probably damaging 1.00
R8322:Lrpprc UTSW 17 84740068 critical splice donor site probably null
R8389:Lrpprc UTSW 17 84773314 missense possibly damaging 0.79
X0026:Lrpprc UTSW 17 84710662 missense probably benign 0.42
Z1088:Lrpprc UTSW 17 84731784 nonsense probably null
Z1088:Lrpprc UTSW 17 84770500 critical splice acceptor site probably null
Z1176:Lrpprc UTSW 17 84770431 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTTAGAAATCACAGACCACGTC -3'
(R):5'- TTTGCGGCACTGTGTGACTC -3'

Sequencing Primer
(F):5'- GGCTAGCTCAGACACACTTATTAATG -3'
(R):5'- ACTCTGGATTTGGTATTCTGCC -3'
Posted On2014-10-01