Incidental Mutation 'R2135:Cfap74'
ID235706
Institutional Source Beutler Lab
Gene Symbol Cfap74
Ensembl Gene ENSMUSG00000078490
Gene Namecilia and flagella associated protein 74
Synonyms2010015L04Rik
MMRRC Submission 040138-MU
Accession Numbers

NCBI RefSeq: isoform 1: NM_177674.5; isoform 2: NM_001166029.1; MGI: 1917130

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2135 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155409190-155466823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155429951 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 548 (L548Q)
Ref Sequence ENSEMBL: ENSMUSP00000123626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151083]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094408
SMART Domains Protein: ENSMUSP00000091975
Gene: ENSMUSG00000042233

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151083
AA Change: L548Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123626
Gene: ENSMUSG00000078490
AA Change: L548Q

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165947
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Cfap74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Cfap74 APN 4 155418986 missense possibly damaging 0.95
paranoid UTSW 4 155454024 utr 5 prime probably benign
sensibile UTSW 4 155441286 missense probably null 0.03
touchy UTSW 4 155463072 missense probably benign 0.27
FR4304:Cfap74 UTSW 4 155415760 missense possibly damaging 0.93
P0007:Cfap74 UTSW 4 155422228 missense possibly damaging 0.83
PIT4434001:Cfap74 UTSW 4 155463964 missense unknown
R0025:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0034:Cfap74 UTSW 4 155460887 splice site probably benign
R0193:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0306:Cfap74 UTSW 4 155465439 unclassified probably benign
R0427:Cfap74 UTSW 4 155441277 missense probably benign 0.02
R0905:Cfap74 UTSW 4 155418696 critical splice donor site probably null
R1116:Cfap74 UTSW 4 155433996 missense probably benign 0.15
R1548:Cfap74 UTSW 4 155434045 missense probably benign 0.45
R1950:Cfap74 UTSW 4 155427430 critical splice donor site probably null
R2009:Cfap74 UTSW 4 155420267 missense possibly damaging 0.77
R2029:Cfap74 UTSW 4 155442081 missense possibly damaging 0.74
R2135:Cfap74 UTSW 4 155429940 missense probably damaging 0.97
R2154:Cfap74 UTSW 4 155429296 missense possibly damaging 0.94
R2413:Cfap74 UTSW 4 155418624 missense possibly damaging 0.76
R2418:Cfap74 UTSW 4 155455709 utr 5 prime probably benign
R2930:Cfap74 UTSW 4 155438170 missense probably damaging 0.97
R3965:Cfap74 UTSW 4 155446717 missense probably damaging 1.00
R4078:Cfap74 UTSW 4 155455671 missense probably damaging 0.98
R4238:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4239:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4240:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4491:Cfap74 UTSW 4 155429171 missense probably benign 0.22
R4731:Cfap74 UTSW 4 155463602 intron probably benign
R5333:Cfap74 UTSW 4 155436740 missense probably damaging 0.99
R5362:Cfap74 UTSW 4 155438166 missense probably damaging 0.98
R5425:Cfap74 UTSW 4 155455692 utr 5 prime probably benign
R5468:Cfap74 UTSW 4 155426041 missense probably benign 0.27
R5839:Cfap74 UTSW 4 155422750 critical splice donor site probably null
R6010:Cfap74 UTSW 4 155454038 missense possibly damaging 0.83
R6284:Cfap74 UTSW 4 155451796 missense probably damaging 0.96
R6323:Cfap74 UTSW 4 155463938 missense possibly damaging 0.54
R6389:Cfap74 UTSW 4 155423336 missense possibly damaging 0.69
R6513:Cfap74 UTSW 4 155441286 missense probably null 0.03
R6527:Cfap74 UTSW 4 155422265 unclassified probably null
R6785:Cfap74 UTSW 4 155454024 utr 5 prime probably benign
R6980:Cfap74 UTSW 4 155466352 unclassified probably benign
R7039:Cfap74 UTSW 4 155454108 critical splice donor site probably null
R7077:Cfap74 UTSW 4 155455677 missense unknown
R7116:Cfap74 UTSW 4 155455061 missense unknown
R7202:Cfap74 UTSW 4 155426197 splice site probably null
R7227:Cfap74 UTSW 4 155460948 nonsense probably null
R7228:Cfap74 UTSW 4 155465050 missense unknown
R7261:Cfap74 UTSW 4 155465374 missense unknown
R7315:Cfap74 UTSW 4 155463019 missense unknown
R7337:Cfap74 UTSW 4 155460015 missense unknown
R7354:Cfap74 UTSW 4 155465347 missense unknown
R7533:Cfap74 UTSW 4 155415743 missense
R7673:Cfap74 UTSW 4 155463056 missense unknown
R7798:Cfap74 UTSW 4 155422622 missense
R7829:Cfap74 UTSW 4 155429237 missense
R7897:Cfap74 UTSW 4 155429894 missense
R7980:Cfap74 UTSW 4 155429894 missense
T0970:Cfap74 UTSW 4 155463117 splice site probably null
X0066:Cfap74 UTSW 4 155463964 missense probably damaging 1.00
Z1176:Cfap74 UTSW 4 155426118 missense
Z1177:Cfap74 UTSW 4 155454913 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCCTTCTCAGACCTCAAGG -3'
(R):5'- GAAGACTTAGGCAGCCCATCTG -3'

Sequencing Primer
(F):5'- CTCAAGGTGGGCATCATGAC -3'
(R):5'- GCCCATCTGAAAGCTTGGTCATG -3'
Posted On2014-10-01