Incidental Mutation 'R2135:Slc25a40'
ID235708
Institutional Source Beutler Lab
Gene Symbol Slc25a40
Ensembl Gene ENSMUSG00000054099
Gene Namesolute carrier family 25, member 40
Synonyms
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2135 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8422850-8454797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8427489 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000142511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002368] [ENSMUST00000066921] [ENSMUST00000168500] [ENSMUST00000170496] [ENSMUST00000171808] [ENSMUST00000196727] [ENSMUST00000198792]
Predicted Effect probably benign
Transcript: ENSMUST00000002368
SMART Domains Protein: ENSMUSP00000002368
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 287 334 7.09e-28 SMART
low complexity region 643 657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066921
AA Change: T25A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000067611
Gene: ENSMUSG00000054099
AA Change: T25A

DomainStartEndE-ValueType
Pfam:Mito_carr 13 137 1.5e-24 PFAM
Pfam:Mito_carr 139 229 4.6e-20 PFAM
Pfam:Mito_carr 232 333 3.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166364
Predicted Effect probably benign
Transcript: ENSMUST00000168500
SMART Domains Protein: ENSMUSP00000132985
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Pfam:BRCT 41 179 2e-7 PFAM
low complexity region 182 204 N/A INTRINSIC
PDB:4F9C|B 210 308 2e-42 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170496
AA Change: T25A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130630
Gene: ENSMUSG00000054099
AA Change: T25A

DomainStartEndE-ValueType
Pfam:Mito_carr 13 137 5.8e-24 PFAM
Pfam:Mito_carr 141 229 1.4e-17 PFAM
Pfam:Mito_carr 232 333 2.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170927
Predicted Effect probably benign
Transcript: ENSMUST00000171808
SMART Domains Protein: ENSMUSP00000132906
Gene: ENSMUSG00000002297

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 288 335 7.09e-28 SMART
low complexity region 644 658 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196727
AA Change: T25A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142511
Gene: ENSMUSG00000054099
AA Change: T25A

DomainStartEndE-ValueType
Pfam:Mito_carr 13 80 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198785
Predicted Effect probably benign
Transcript: ENSMUST00000198792
AA Change: T25A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143045
Gene: ENSMUSG00000054099
AA Change: T25A

DomainStartEndE-ValueType
Pfam:Mito_carr 13 129 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199817
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A40 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and overtly normal in a battery of physiological, metabolic, and behavioral assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Slc25a40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Slc25a40 APN 5 8453298 makesense probably null
IGL01418:Slc25a40 APN 5 8453298 makesense probably null
IGL02604:Slc25a40 APN 5 8453219 missense probably benign
IGL03371:Slc25a40 APN 5 8427442 missense probably benign 0.01
PIT4494001:Slc25a40 UTSW 5 8440737 missense probably damaging 1.00
R0443:Slc25a40 UTSW 5 8447348 missense probably benign 0.05
R1051:Slc25a40 UTSW 5 8430450 missense probably benign
R1707:Slc25a40 UTSW 5 8440793 splice site probably null
R1861:Slc25a40 UTSW 5 8442431 intron probably null
R2117:Slc25a40 UTSW 5 8430417 missense probably damaging 1.00
R2567:Slc25a40 UTSW 5 8430459 missense probably damaging 1.00
R2908:Slc25a40 UTSW 5 8427505 missense probably damaging 1.00
R5140:Slc25a40 UTSW 5 8430486 missense probably damaging 0.96
R5269:Slc25a40 UTSW 5 8447409 critical splice donor site probably null
R6665:Slc25a40 UTSW 5 8452788 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACACTGGCTTCCATTTATAAC -3'
(R):5'- TGGTTTTCCTCATGCACACGTG -3'

Sequencing Primer
(F):5'- ATGTTAGGCAAGCACTCCTG -3'
(R):5'- GTGCACAAATAACAAACATGCATATG -3'
Posted On2014-10-01