Incidental Mutation 'R2135:Zfyve26'
ID235740
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2135 (G1)
Quality Score217
Status Validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79246052 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 2108 (R2108G)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021547
AA Change: R2108G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: R2108G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220390
Meta Mutation Damage Score 0.1214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 intron probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0738:Zfyve26 UTSW 12 79295534 missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79275040 missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79249695 intron probably null
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79282984 missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 intron probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79268635 missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79280355 critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79255324 missense probably damaging 1.00
RF010:Zfyve26 UTSW 12 79255338 missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACACAGAGAAACCCTG -3'
(R):5'- TTGATTCCACAGGAGCATGG -3'

Sequencing Primer
(F):5'- GGCTACACAGAGAAACCCTGTTTTG -3'
(R):5'- GGAACCTCACTGTTGCAA -3'
Posted On2014-10-01