Incidental Mutation 'R2135:Msra'
ID235748
Institutional Source Beutler Lab
Gene Symbol Msra
Ensembl Gene ENSMUSG00000054733
Gene Namemethionine sulfoxide reductase A
Synonyms2310045J23Rik, MSR-A, 6530413P12Rik
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2135 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64122625-64455903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64123208 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 228 (P228L)
Ref Sequence ENSEMBL: ENSMUSP00000065754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067927] [ENSMUST00000210363] [ENSMUST00000210428]
PDB Structure
Solution structure of murine myristoylated msrA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000067927
AA Change: P228L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065754
Gene: ENSMUSG00000054733
AA Change: P228L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:PMSR 65 219 2.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210363
AA Change: P164L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000210428
AA Change: P186L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225122
Meta Mutation Damage Score 0.7270 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this allele display an increased sensitivity to oxidative stress, reductions in related enzyme levels, and reduced life spans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Ext1 G T 15: 53,101,744 Q409K possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Msra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Msra APN 14 64123325 missense probably damaging 0.99
IGL01301:Msra APN 14 64210435 missense probably damaging 1.00
IGL02500:Msra APN 14 64285188 splice site probably benign
IGL03227:Msra APN 14 64313743 missense probably benign 0.06
ANU18:Msra UTSW 14 64210435 missense probably damaging 1.00
R0485:Msra UTSW 14 64440761 missense possibly damaging 0.64
R0632:Msra UTSW 14 64210532 missense probably benign 0.04
R1557:Msra UTSW 14 64123326 missense possibly damaging 0.75
R1940:Msra UTSW 14 64285056 splice site probably benign
R2133:Msra UTSW 14 64233928 missense probably damaging 1.00
R6119:Msra UTSW 14 64440734 missense probably damaging 1.00
R6602:Msra UTSW 14 64123339 missense probably benign 0.01
R7233:Msra UTSW 14 64123265 missense probably damaging 1.00
R7249:Msra UTSW 14 64440763 missense probably benign 0.17
R8047:Msra UTSW 14 64285163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTGTATCACCTTGTCATGC -3'
(R):5'- TCAAGGAGTCCTGTGTCCAG -3'

Sequencing Primer
(F):5'- GTCATGCTACTCTCTGGAAATCAAAC -3'
(R):5'- AAGGAGTCCTGTGTCCAGCATTG -3'
Posted On2014-10-01