Incidental Mutation 'R2135:Ext1'
ID235752
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Nameexostoses (multiple) 1
Synonyms
MMRRC Submission 040138-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2135 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location53064038-53346159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53101744 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 409 (Q409K)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000110244] [ENSMUST00000133362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077273
AA Change: Q409K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: Q409K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110244
SMART Domains Protein: ENSMUSP00000105873
Gene: ENSMUSG00000061731

DomainStartEndE-ValueType
Pfam:Exostosin 4 82 1.1e-29 PFAM
Pfam:Glyco_transf_64 166 239 2.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140798
Meta Mutation Damage Score 0.1587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,643 H116Q probably benign Het
9230110F15Rik A C 9: 35,839,183 probably null Het
Adamts16 C A 13: 70,801,007 L178F probably damaging Het
Adgrv1 A G 13: 81,524,557 probably null Het
Akap9 A G 5: 4,064,509 T46A probably damaging Het
Ankrd2 T C 19: 42,044,059 L253P probably damaging Het
Arap3 T C 18: 37,974,456 D1336G probably damaging Het
Cacna2d2 C A 9: 107,526,513 L992I possibly damaging Het
Cdhr2 T A 13: 54,720,947 I574N probably damaging Het
Cecr2 C T 6: 120,720,962 T74M probably damaging Het
Ces5a C A 8: 93,499,741 E481D probably benign Het
Cfap74 C G 4: 155,429,940 N544K probably damaging Het
Cfap74 T A 4: 155,429,951 L548Q probably damaging Het
Cfb C T 17: 34,857,278 V1145I possibly damaging Het
CK137956 A G 4: 127,951,640 probably benign Het
Commd10 T A 18: 46,990,537 L153Q possibly damaging Het
Cox6c T C 15: 35,937,283 probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Ermp1 T C 19: 29,646,065 D119G possibly damaging Het
Fat4 A T 3: 38,980,733 I2845F probably damaging Het
Frmd6 A G 12: 70,894,997 N494S probably benign Het
Fscn3 A G 6: 28,431,584 T305A probably benign Het
Gbx1 G T 5: 24,526,222 R199S possibly damaging Het
Gm11437 T C 11: 84,153,812 R192G probably damaging Het
Gucy2c T A 6: 136,723,728 D572V probably damaging Het
Idh1 A C 1: 65,161,919 M291R probably damaging Het
Kcnt2 A G 1: 140,428,813 Y330C probably damaging Het
Kdm4a A G 4: 118,142,459 L922P probably damaging Het
L3mbtl2 A G 15: 81,682,014 D346G possibly damaging Het
Lsm14a A G 7: 34,371,184 S96P probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
March6 A T 15: 31,509,764 C26* probably null Het
Msra G A 14: 64,123,208 P228L probably damaging Het
Mycbp2 A T 14: 103,145,942 D395E probably benign Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Ncr1 C A 7: 4,340,757 probably benign Het
Nkd1 T C 8: 88,591,650 I201T probably benign Het
Nsrp1 A T 11: 77,055,008 probably benign Het
Olfr330 A C 11: 58,529,785 I67S probably damaging Het
Olfr873 T A 9: 20,300,297 D32E probably benign Het
Pkdrej T C 15: 85,816,506 Y1743C probably damaging Het
Plekha5 T A 6: 140,580,499 H281Q possibly damaging Het
Ppp2r3a A C 9: 101,211,558 M522R probably damaging Het
Prdm12 T C 2: 31,640,313 F72S possibly damaging Het
Prima1 A T 12: 103,202,690 F106L probably damaging Het
Ptchd4 A G 17: 42,317,074 H142R probably benign Het
Rasgrf2 G A 13: 91,972,255 A793V probably benign Het
Rbsn T A 6: 92,189,873 M597L probably benign Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Rp9 T C 9: 22,468,129 K25E possibly damaging Het
Sec31b T C 19: 44,534,696 S211G probably damaging Het
Shank2 C T 7: 144,411,234 P1070S probably damaging Het
Sla A G 15: 66,782,714 V241A probably benign Het
Slc25a40 A G 5: 8,427,489 T25A possibly damaging Het
Slc3a2 A G 19: 8,708,244 S164P probably benign Het
Slc7a5 A T 8: 121,883,705 W457R probably null Het
Slco6c1 A G 1: 97,104,817 M303T probably benign Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Tecta A C 9: 42,340,285 C1781G probably damaging Het
Timmdc1 A T 16: 38,498,951 H280Q probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem30b A G 12: 73,545,333 L336P probably damaging Het
Tmem94 A G 11: 115,794,749 I943V probably benign Het
Tshb A G 3: 102,778,148 probably null Het
Vcpip1 A G 1: 9,747,810 V116A probably benign Het
Vmn2r76 A G 7: 86,231,011 Y156H probably benign Het
Zcrb1 T C 15: 93,397,186 N23S probably damaging Het
Zfyve26 T C 12: 79,246,052 R2108G possibly damaging Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACTAAACTATGCAAGGACAG -3'
(R):5'- CCATCATTTCAGCCTGGGTG -3'

Sequencing Primer
(F):5'- GACAGGAAATTTGGTTTTGTCCTAC -3'
(R):5'- GACCTGTTTTCTAGAAAATGAATGC -3'
Posted On2014-10-01