Mutagenetix > Incidental Mutation

Incidental Mutation 'R2135:Ltn1'

235758

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

040138-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2135 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87382713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1520 (L1520P)

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449]

AlphaFold

Q6A009

Predicted Effect

probably damaging
Transcript: ENSMUST00000039449
AA Change: L1520P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: L1520P

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Meta Mutation Damage Score

0.9181

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,643	H116Q	probably benign	Het
9230110F15Rik	A	C	9: 35,839,183		probably null	Het
Adamts16	C	A	13: 70,801,007	L178F	probably damaging	Het
Adgrv1	A	G	13: 81,524,557		probably null	Het
Akap9	A	G	5: 4,064,509	T46A	probably damaging	Het
Ankrd2	T	C	19: 42,044,059	L253P	probably damaging	Het
Arap3	T	C	18: 37,974,456	D1336G	probably damaging	Het
Cacna2d2	C	A	9: 107,526,513	L992I	possibly damaging	Het
Cdhr2	T	A	13: 54,720,947	I574N	probably damaging	Het
Cecr2	C	T	6: 120,720,962	T74M	probably damaging	Het
Ces5a	C	A	8: 93,499,741	E481D	probably benign	Het
Cfap74	C	G	4: 155,429,940	N544K	probably damaging	Het
Cfap74	T	A	4: 155,429,951	L548Q	probably damaging	Het
Cfb	C	T	17: 34,857,278	V1145I	possibly damaging	Het
CK137956	A	G	4: 127,951,640		probably benign	Het
Commd10	T	A	18: 46,990,537	L153Q	possibly damaging	Het
Cox6c	T	C	15: 35,937,283		probably benign	Het
Dock4	A	G	12: 40,745,668	Y828C	probably benign	Het
Ermp1	T	C	19: 29,646,065	D119G	possibly damaging	Het
Ext1	G	T	15: 53,101,744	Q409K	possibly damaging	Het
Fat4	A	T	3: 38,980,733	I2845F	probably damaging	Het
Frmd6	A	G	12: 70,894,997	N494S	probably benign	Het
Fscn3	A	G	6: 28,431,584	T305A	probably benign	Het
Gbx1	G	T	5: 24,526,222	R199S	possibly damaging	Het
Gm11437	T	C	11: 84,153,812	R192G	probably damaging	Het
Gucy2c	T	A	6: 136,723,728	D572V	probably damaging	Het
Idh1	A	C	1: 65,161,919	M291R	probably damaging	Het
Kcnt2	A	G	1: 140,428,813	Y330C	probably damaging	Het
Kdm4a	A	G	4: 118,142,459	L922P	probably damaging	Het
L3mbtl2	A	G	15: 81,682,014	D346G	possibly damaging	Het
Lsm14a	A	G	7: 34,371,184	S96P	probably damaging	Het
March6	A	T	15: 31,509,764	C26*	probably null	Het
Msra	G	A	14: 64,123,208	P228L	probably damaging	Het
Mycbp2	A	T	14: 103,145,942	D395E	probably benign	Het
Mycbp2	T	C	14: 103,208,893	Y1800C	probably damaging	Het
Ncr1	C	A	7: 4,340,757		probably benign	Het
Nkd1	T	C	8: 88,591,650	I201T	probably benign	Het
Nsrp1	A	T	11: 77,055,008		probably benign	Het
Olfr330	A	C	11: 58,529,785	I67S	probably damaging	Het
Olfr873	T	A	9: 20,300,297	D32E	probably benign	Het
Pkdrej	T	C	15: 85,816,506	Y1743C	probably damaging	Het
Plekha5	T	A	6: 140,580,499	H281Q	possibly damaging	Het
Ppp2r3a	A	C	9: 101,211,558	M522R	probably damaging	Het
Prdm12	T	C	2: 31,640,313	F72S	possibly damaging	Het
Prima1	A	T	12: 103,202,690	F106L	probably damaging	Het
Ptchd4	A	G	17: 42,317,074	H142R	probably benign	Het
Rasgrf2	G	A	13: 91,972,255	A793V	probably benign	Het
Rbsn	T	A	6: 92,189,873	M597L	probably benign	Het
Ripk4	A	T	16: 97,743,733	D571E	probably damaging	Het
Rp9	T	C	9: 22,468,129	K25E	possibly damaging	Het
Sec31b	T	C	19: 44,534,696	S211G	probably damaging	Het
Shank2	C	T	7: 144,411,234	P1070S	probably damaging	Het
Sla	A	G	15: 66,782,714	V241A	probably benign	Het
Slc25a40	A	G	5: 8,427,489	T25A	possibly damaging	Het
Slc3a2	A	G	19: 8,708,244	S164P	probably benign	Het
Slc7a5	A	T	8: 121,883,705	W457R	probably null	Het
Slco6c1	A	G	1: 97,104,817	M303T	probably benign	Het
Smim10l1	T	C	6: 133,105,526	F12S	probably damaging	Het
Syne2	A	G	12: 75,952,786	I2318V	probably damaging	Het
Tecta	A	C	9: 42,340,285	C1781G	probably damaging	Het
Timmdc1	A	T	16: 38,498,951	H280Q	probably benign	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tmem30b	A	G	12: 73,545,333	L336P	probably damaging	Het
Tmem94	A	G	11: 115,794,749	I943V	probably benign	Het
Tshb	A	G	3: 102,778,148		probably null	Het
Vcpip1	A	G	1: 9,747,810	V116A	probably benign	Het
Vmn2r76	A	G	7: 86,231,011	Y156H	probably benign	Het
Zcrb1	T	C	15: 93,397,186	N23S	probably damaging	Het
Zfyve26	T	C	12: 79,246,052	R2108G	possibly damaging	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACGTTACGCACATGTAGCCC -3'
(R):5'- GTTAGTGTTCTGCCACTGACCTAC -3'

Sequencing Primer
(F):5'- CATGTAGCCCACAGACGTGTAG -3'
(R):5'- CCACGTGTGGGGATACATTCTAC -3'

Posted On

2014-10-01