Incidental Mutation 'R2136:Cfap65'
ID 235770
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 040139-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R2136 (G1)
Quality Score 217
Status Not validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) C to CA at 74956432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably null
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T G 16: 19,702,530 (GRCm39) noncoding transcript Het
Abca5 T C 11: 110,210,658 (GRCm39) T174A probably benign Het
Abcg3 G A 5: 105,114,680 (GRCm39) S279L probably benign Het
Acap3 T C 4: 155,981,369 (GRCm39) L85P probably damaging Het
Adgrl3 A G 5: 81,660,101 (GRCm39) K290R probably damaging Het
Ankhd1 A G 18: 36,780,674 (GRCm39) T1909A probably benign Het
Asap1 T C 15: 63,982,808 (GRCm39) D832G probably damaging Het
Atp6v0a2 T A 5: 124,795,552 (GRCm39) L702Q possibly damaging Het
Bsn A G 9: 107,990,430 (GRCm39) V1774A probably damaging Het
Cd209e T C 8: 3,903,248 (GRCm39) E48G probably benign Het
Cdadc1 T C 14: 59,805,493 (GRCm39) probably null Het
Cln3 A C 7: 126,181,971 (GRCm39) S30R probably benign Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Crb1 A T 1: 139,265,163 (GRCm39) V85E probably benign Het
Crocc G A 4: 140,760,265 (GRCm39) R789W probably damaging Het
Cwh43 A G 5: 73,572,397 (GRCm39) I212V probably benign Het
Cyp2t4 C A 7: 26,857,585 (GRCm39) F391L probably benign Het
Dhx35 G T 2: 158,673,781 (GRCm39) R404L probably damaging Het
Disp1 A G 1: 182,869,942 (GRCm39) L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Ep300 T A 15: 81,524,648 (GRCm39) Y1393N unknown Het
Fap C T 2: 62,354,551 (GRCm39) G446D possibly damaging Het
Fat3 A G 9: 16,288,347 (GRCm39) I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Glipr1l1 T C 10: 111,896,381 (GRCm39) V56A probably damaging Het
Grsf1 A G 5: 88,820,517 (GRCm39) V7A probably benign Het
Hmcn1 G A 1: 150,509,410 (GRCm39) A3646V probably damaging Het
Ipo9 A T 1: 135,322,023 (GRCm39) I569N probably damaging Het
Irs1 G T 1: 82,267,763 (GRCm39) P151Q probably damaging Het
Kalrn T C 16: 34,128,094 (GRCm39) D491G possibly damaging Het
Kctd7 T C 5: 130,181,207 (GRCm39) L210P probably damaging Het
Lifr C A 15: 7,211,338 (GRCm39) D625E possibly damaging Het
Lrguk T C 6: 34,020,454 (GRCm39) V201A probably benign Het
Mark1 A G 1: 184,651,770 (GRCm39) V135A probably damaging Het
Mical2 T A 7: 111,870,722 (GRCm39) D70E possibly damaging Het
Mrc1 T C 2: 14,275,000 (GRCm39) Y434H probably damaging Het
Myh10 C A 11: 68,695,540 (GRCm39) Q1556K probably damaging Het
Nav1 G A 1: 135,382,174 (GRCm39) T1400I probably null Het
Or1j11 A G 2: 36,311,950 (GRCm39) D180G probably damaging Het
Or2a7 A G 6: 43,151,435 (GRCm39) K172E probably benign Het
Or4b13 A C 2: 90,082,597 (GRCm39) V245G probably damaging Het
Or4f4b T C 2: 111,313,961 (GRCm39) V62A probably damaging Het
Or4p7 T A 2: 88,221,663 (GRCm39) I24N probably benign Het
Or5d43 T C 2: 88,104,584 (GRCm39) K270E probably damaging Het
Or5e1 G A 7: 108,354,430 (GRCm39) M122I possibly damaging Het
Osmr T A 15: 6,881,943 (GRCm39) Q67L probably damaging Het
Pan2 T G 10: 128,149,506 (GRCm39) V522G possibly damaging Het
Pard3 T G 8: 128,103,366 (GRCm39) probably null Het
Pcdhgc5 G T 18: 37,953,166 (GRCm39) A147S possibly damaging Het
Pcsk9 T C 4: 106,303,967 (GRCm39) I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,680,487 (GRCm39) probably null Het
Prdm4 G A 10: 85,729,215 (GRCm39) R731* probably null Het
Prdx6b T A 2: 80,123,507 (GRCm39) D105E probably damaging Het
Prss3b A G 6: 41,012,396 (GRCm39) F6S probably benign Het
Rab42 A G 4: 132,029,790 (GRCm39) L144P probably damaging Het
Ralbp1 T A 17: 66,171,661 (GRCm39) K104M probably damaging Het
Resf1 T A 6: 149,230,320 (GRCm39) I1122K probably benign Het
Rrp12 A G 19: 41,881,038 (GRCm39) V131A probably damaging Het
Sbno1 C T 5: 124,525,597 (GRCm39) probably null Het
Sbno2 A T 10: 79,898,527 (GRCm39) I645N probably damaging Het
Scfd2 T C 5: 74,367,028 (GRCm39) K624R probably benign Het
Sgk2 C A 2: 162,841,099 (GRCm39) probably null Het
Sirt4 A G 5: 115,617,760 (GRCm39) S299P probably benign Het
Skic3 T C 13: 76,321,473 (GRCm39) S1322P possibly damaging Het
Slit2 C T 5: 48,461,567 (GRCm39) A1521V probably benign Het
Socs7 T G 11: 97,263,933 (GRCm39) V275G possibly damaging Het
Spink11 G A 18: 44,323,554 (GRCm39) P102S probably benign Het
Tacc3 A G 5: 33,828,748 (GRCm39) N534D probably damaging Het
Tas2r115 T C 6: 132,714,309 (GRCm39) Y214C probably damaging Het
Tcaf1 A T 6: 42,650,454 (GRCm39) M875K probably benign Het
Ttc22 T A 4: 106,479,869 (GRCm39) L41Q possibly damaging Het
Vasn T A 16: 4,467,659 (GRCm39) C535* probably null Het
Vcan T A 13: 89,837,856 (GRCm39) I2563F probably damaging Het
Vmn2r63 T G 7: 42,576,297 (GRCm39) Q505H probably damaging Het
Vmn2r65 T G 7: 84,592,781 (GRCm39) Q475H probably damaging Het
Zbtb43 T C 2: 33,344,532 (GRCm39) Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 (GRCm39) V931A probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCAGCTTCTTGGGAAAGG -3'
(R):5'- GCTCAAGATTGAAGCTGAGCC -3'

Sequencing Primer
(F):5'- AGCTTCTTGGGAAAGGCCTGG -3'
(R):5'- AAGATTGAAGCTGAGCCACTGTTTG -3'
Posted On 2014-10-01