Mutagenetix > Incidental Mutation

Incidental Mutation 'R2136:Cfap65'

235770

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

040139-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R2136 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

C to CA at 74917273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably null
Transcript: ENSMUST00000094844

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTCAGCTTCTTGGGAAAGG -3'
(R):5'- GCTCAAGATTGAAGCTGAGCC -3'

Sequencing Primer
(F):5'- AGCTTCTTGGGAAAGGCCTGG -3'
(R):5'- AAGATTGAAGCTGAGCCACTGTTTG -3'

Posted On

2014-10-01