Incidental Mutation 'R2136:Cfap65'
ID235770
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R2136 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) C to CA at 74917273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably null
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTCAGCTTCTTGGGAAAGG -3'
(R):5'- GCTCAAGATTGAAGCTGAGCC -3'

Sequencing Primer
(F):5'- AGCTTCTTGGGAAAGGCCTGG -3'
(R):5'- AAGATTGAAGCTGAGCCACTGTTTG -3'
Posted On2014-10-01