Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Irs1'

235771

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.603) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 82290042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 151 (P151Q)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069799
AA Change: P151Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: P151Q

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TGGCCACAGCGTCTGATATTC -3'
(R):5'- CCAAGAACAAGCACCTGGTG -3'

Sequencing Primer
(F):5'- TGATATTCATCAGCTGCAGCAC -3'
(R):5'- GAGACGAACACTTTGCCATTG -3'

Posted On

2014-10-01