Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Crb1'

235774

Institutional Source

Beutler Lab

Gene Symbol

Crb1

Ensembl Gene

ENSMUSG00000063681

Gene Name

crumbs family member 1, photoreceptor morphogenesis associated

Synonyms

7530426H14Rik, A930008G09Rik

MMRRC Submission

040139-MU

Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139197056-139377100 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139337425 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 85 (V85E)

Ref Sequence

ENSEMBL: ENSMUSP00000142702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445]

Predicted Effect

probably benign
Transcript: ENSMUST00000059825
AA Change: V85E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: V85E

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
EGF	72	107	5.97e-4	SMART
EGF	112	145	9.19e-5	SMART
EGF_CA	147	183	2.89e-11	SMART
EGF_CA	185	221	1.14e-9	SMART
EGF_CA	223	259	2.26e-13	SMART
EGF_CA	261	298	5.15e-8	SMART
EGF	303	336	8.12e-6	SMART
EGF	341	394	2.6e-4	SMART
EGF_CA	396	438	2.54e-7	SMART
EGF	443	480	1.47e-3	SMART
LamG	505	650	1.75e-9	SMART
EGF	674	707	6.5e-5	SMART
LamG	734	859	1.05e-7	SMART
EGF	889	922	1.19e-3	SMART
LamG	971	1104	6.85e-12	SMART
EGF	1141	1174	7.07e-6	SMART
EGF_CA	1176	1211	3.01e-9	SMART
EGF	1216	1249	3.57e-2	SMART
EGF	1257	1294	6.92e0	SMART
EGF_CA	1296	1332	4.19e-8	SMART
transmembrane domain	1346	1368	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196402
AA Change: V85E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681
AA Change: V85E

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
EGF	72	107	5.97e-4	SMART
EGF	112	145	9.19e-5	SMART
EGF_CA	147	183	2.89e-11	SMART
EGF_CA	185	221	1.14e-9	SMART
EGF_CA	223	259	2.26e-13	SMART
EGF_CA	261	298	5.15e-8	SMART
EGF	303	336	8.12e-6	SMART
EGF	341	394	2.6e-4	SMART
EGF_CA	396	438	2.54e-7	SMART
EGF	443	480	1.47e-3	SMART
LamG	505	650	1.75e-9	SMART
EGF	674	707	6.5e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000198445
AA Change: V85E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: V85E

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
EGF	72	107	5.97e-4	SMART
EGF	112	145	9.19e-5	SMART
EGF_CA	147	183	2.89e-11	SMART
EGF_CA	185	221	1.14e-9	SMART
EGF_CA	223	259	2.26e-13	SMART
EGF_CA	261	298	5.15e-8	SMART
EGF	303	333	1.63e1	SMART
EGF_CA	335	377	2.54e-7	SMART
EGF	382	419	1.47e-3	SMART
LamG	444	589	1.75e-9	SMART
EGF	613	646	6.5e-5	SMART
LamG	673	798	1.05e-7	SMART
EGF	828	861	1.19e-3	SMART
LamG	910	1043	6.85e-12	SMART
EGF	1080	1113	7.07e-6	SMART
EGF_CA	1115	1150	3.01e-9	SMART
EGF	1155	1188	3.57e-2	SMART
EGF	1196	1233	6.92e0	SMART
EGF_CA	1235	1271	4.19e-8	SMART
low complexity region	1282	1296	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Crb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Crb1	APN	1	139323245	missense	probably benign	0.16
IGL01591:Crb1	APN	1	139237339	missense	probably damaging	1.00
IGL01644:Crb1	APN	1	139237630	nonsense	probably null
IGL01769:Crb1	APN	1	139337068	missense	probably damaging	1.00
IGL02172:Crb1	APN	1	139237227	missense	probably damaging	1.00
IGL02294:Crb1	APN	1	139234782	missense	possibly damaging	0.89
IGL02382:Crb1	APN	1	139237614	missense	probably damaging	0.99
IGL02411:Crb1	APN	1	139248475	missense	probably damaging	1.00
IGL03070:Crb1	APN	1	139241258	missense	possibly damaging	0.79
IGL02984:Crb1	UTSW	1	139237086	frame shift	probably null
IGL02988:Crb1	UTSW	1	139237086	frame shift	probably null
IGL02991:Crb1	UTSW	1	139237084	frame shift	probably null
IGL02991:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03014:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03050:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03054:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03055:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03097:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03098:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03134:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03138:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03147:Crb1	UTSW	1	139237086	frame shift	probably null
P0017:Crb1	UTSW	1	139248940	missense	possibly damaging	0.64
R0276:Crb1	UTSW	1	139323335	missense	possibly damaging	0.85
R0325:Crb1	UTSW	1	139241166	missense	probably damaging	1.00
R0401:Crb1	UTSW	1	139198791	splice site	probably benign
R0479:Crb1	UTSW	1	139198614	missense	probably damaging	0.98
R0734:Crb1	UTSW	1	139337084	missense	probably benign	0.25
R1573:Crb1	UTSW	1	139337606	missense	probably damaging	1.00
R1728:Crb1	UTSW	1	139234779	missense	probably benign
R1728:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1728:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1728:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1728:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1729:Crb1	UTSW	1	139234779	missense	probably benign
R1729:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1729:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1729:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1729:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1730:Crb1	UTSW	1	139234779	missense	probably benign
R1730:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1730:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1730:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1730:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1739:Crb1	UTSW	1	139234779	missense	probably benign
R1739:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1739:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1739:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1739:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1762:Crb1	UTSW	1	139234779	missense	probably benign
R1762:Crb1	UTSW	1	139237531	missense	probably damaging	1.00
R1762:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1762:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1762:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1762:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1783:Crb1	UTSW	1	139234779	missense	probably benign
R1783:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1783:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1783:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1783:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1784:Crb1	UTSW	1	139234779	missense	probably benign
R1784:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1784:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1784:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1784:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1785:Crb1	UTSW	1	139234779	missense	probably benign
R1785:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1785:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1785:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1785:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1848:Crb1	UTSW	1	139237012	missense	probably damaging	0.97
R1894:Crb1	UTSW	1	139243193	missense	probably benign	0.02
R2057:Crb1	UTSW	1	139314750	missense	probably damaging	1.00
R2140:Crb1	UTSW	1	139237012	missense	probably benign	0.01
R2363:Crb1	UTSW	1	139337278	missense	possibly damaging	0.89
R3605:Crb1	UTSW	1	139237339	missense	probably damaging	1.00
R3817:Crb1	UTSW	1	139248097	missense	probably benign
R3942:Crb1	UTSW	1	139337473	missense	possibly damaging	0.49
R4272:Crb1	UTSW	1	139323311	missense	probably benign	0.04
R4301:Crb1	UTSW	1	139248830	missense	probably benign	0.01
R4403:Crb1	UTSW	1	139248379	missense	probably benign	0.00
R4700:Crb1	UTSW	1	139198771	missense	probably damaging	0.96
R4771:Crb1	UTSW	1	139328204	missense	probably damaging	1.00
R4845:Crb1	UTSW	1	139243034	missense	probably benign	0.06
R4867:Crb1	UTSW	1	139243014	missense	probably damaging	1.00
R5159:Crb1	UTSW	1	139243018	missense	probably damaging	0.99
R5270:Crb1	UTSW	1	139236864	missense	probably damaging	0.97
R5347:Crb1	UTSW	1	139337371	missense	probably damaging	1.00
R5513:Crb1	UTSW	1	139236821	critical splice donor site	probably null
R5641:Crb1	UTSW	1	139248889	missense	probably damaging	0.99
R5754:Crb1	UTSW	1	139231599	missense	probably damaging	1.00
R5968:Crb1	UTSW	1	139243001	missense	probably damaging	1.00
R6122:Crb1	UTSW	1	139248948	nonsense	probably null
R6369:Crb1	UTSW	1	139237462	missense	probably damaging	1.00
R6809:Crb1	UTSW	1	139243126	missense	probably benign	0.00
R7020:Crb1	UTSW	1	139231603	missense	possibly damaging	0.85
R7072:Crb1	UTSW	1	139237275	missense	probably damaging	1.00
R7073:Crb1	UTSW	1	139248311	missense	probably damaging	0.99
R7135:Crb1	UTSW	1	139243367	missense	probably damaging	0.97
R7493:Crb1	UTSW	1	139237030	missense	probably damaging	1.00
R7539:Crb1	UTSW	1	139248229	missense	probably damaging	1.00
R7554:Crb1	UTSW	1	139337281	missense	probably damaging	1.00
R7593:Crb1	UTSW	1	139237240	missense	probably damaging	1.00
R7740:Crb1	UTSW	1	139237690	missense	probably benign	0.01
R7912:Crb1	UTSW	1	139243171	missense	probably damaging	1.00
R8036:Crb1	UTSW	1	139237384	missense	probably benign	0.07
R8042:Crb1	UTSW	1	139314654	missense	probably damaging	0.99
R8329:Crb1	UTSW	1	139237267	missense	probably damaging	1.00
R8332:Crb1	UTSW	1	139237414	missense	probably damaging	0.96
X0066:Crb1	UTSW	1	139248245	missense	probably benign	0.10
Z1176:Crb1	UTSW	1	139237086	frame shift	probably null
Z1177:Crb1	UTSW	1	139237086	frame shift	probably null
Z1177:Crb1	UTSW	1	139248901	missense	possibly damaging	0.80
Z1177:Crb1	UTSW	1	139337028	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATTGATTCCATCCTGGCACATAG -3'
(R):5'- AAAACAATACCAGGTGCCTTTC -3'

Sequencing Primer
(F):5'- ATAGCCCCATTGTGGCAAG -3'
(R):5'- ACAATACCAGGTGCCTTTCAGGTC -3'

Posted On

2014-10-01