Incidental Mutation 'R2136:Fap'
ID235782
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Namefibroblast activation protein
Synonyms
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location62500943-62574075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62524207 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 446 (G446D)
Ref Sequence ENSEMBL: ENSMUSP00000000402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000174234] [ENSMUST00000174448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000402
AA Change: G446D

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: G446D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102732
AA Change: G479D

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: G479D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172676
Predicted Effect probably benign
Transcript: ENSMUST00000174234
AA Change: G454D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: G454D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174448
AA Change: G474D

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: G474D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62524201 missense possibly damaging 0.82
IGL01420:Fap APN 2 62504502 splice site probably benign
IGL01485:Fap APN 2 62544311 missense possibly damaging 0.80
IGL01987:Fap APN 2 62528676 missense probably damaging 1.00
IGL02198:Fap APN 2 62554798 missense probably benign
IGL02355:Fap APN 2 62573498 missense probably benign 0.02
IGL02362:Fap APN 2 62573498 missense probably benign 0.02
IGL03227:Fap APN 2 62530763 critical splice acceptor site probably null
IGL03266:Fap APN 2 62537022 missense probably benign
IGL03369:Fap APN 2 62503355 splice site probably benign
IGL03406:Fap APN 2 62542122 splice site probably benign
ANU74:Fap UTSW 2 62547769 missense probably damaging 1.00
R0254:Fap UTSW 2 62503402 missense probably damaging 1.00
R0842:Fap UTSW 2 62537001 missense probably damaging 1.00
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1591:Fap UTSW 2 62553857 missense probably damaging 0.99
R1671:Fap UTSW 2 62553835 missense possibly damaging 0.46
R1674:Fap UTSW 2 62519005 missense probably benign
R1795:Fap UTSW 2 62548589 missense probably damaging 1.00
R1869:Fap UTSW 2 62528727 missense probably damaging 1.00
R2032:Fap UTSW 2 62542237 missense probably benign 0.43
R3546:Fap UTSW 2 62519011 missense probably damaging 1.00
R3547:Fap UTSW 2 62519011 missense probably damaging 1.00
R3771:Fap UTSW 2 62533010 missense probably damaging 1.00
R3801:Fap UTSW 2 62546650 missense probably benign 0.04
R3910:Fap UTSW 2 62556104 missense probably damaging 1.00
R4306:Fap UTSW 2 62530707 critical splice donor site probably null
R4323:Fap UTSW 2 62503372 missense probably damaging 0.97
R4517:Fap UTSW 2 62530715 missense probably benign 0.01
R4793:Fap UTSW 2 62544369 missense probably damaging 1.00
R4812:Fap UTSW 2 62519021 missense probably damaging 1.00
R4843:Fap UTSW 2 62544374 missense probably damaging 1.00
R5281:Fap UTSW 2 62532961 critical splice donor site probably null
R5661:Fap UTSW 2 62536963 intron probably benign
R5696:Fap UTSW 2 62502459 missense probably damaging 1.00
R5750:Fap UTSW 2 62528714 missense probably damaging 1.00
R5898:Fap UTSW 2 62573503 missense probably benign
R5907:Fap UTSW 2 62544356 missense probably damaging 1.00
R5944:Fap UTSW 2 62542261 missense probably damaging 1.00
R5991:Fap UTSW 2 62518521 missense probably damaging 1.00
R6110:Fap UTSW 2 62554770 missense possibly damaging 0.91
R6270:Fap UTSW 2 62547788 missense probably damaging 0.98
R6505:Fap UTSW 2 62546603 nonsense probably null
R6631:Fap UTSW 2 62503381 missense probably damaging 1.00
R6896:Fap UTSW 2 62504600 nonsense probably null
R7138:Fap UTSW 2 62542178 missense probably benign 0.10
R7806:Fap UTSW 2 62503414 missense probably damaging 1.00
X0017:Fap UTSW 2 62556180 missense probably benign 0.04
X0026:Fap UTSW 2 62512390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCATGTGATCAGGTTTAAAGC -3'
(R):5'- ACAGAGCAGGTAAGGCTTCTC -3'

Sequencing Primer
(F):5'- AAGCAAACAATATTTCAATCTGTGG -3'
(R):5'- AGAGCAGGTAAGGCTTCTCATAGTTC -3'
Posted On2014-10-01