Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Olfr142'

235786

Institutional Source

Beutler Lab

Gene Symbol

Olfr142

Ensembl Gene

ENSMUSG00000075063

Gene Name

olfactory receptor 142

Synonyms

GA_x6K02T2Q125-51607674-51606757, K20, MOR227-2

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90250130-90257592 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 90252253 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 245 (V245G)

Ref Sequence

ENSEMBL: ENSMUSP00000150216 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099752
AA Change: V245G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: V245G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	4.3e-53	PFAM
Pfam:7TM_GPCR_Srsx	33	300	3e-6	PFAM
Pfam:7tm_1	39	285	5.8e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213968
AA Change: V245G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Dhx35	G	T	2: 158,831,861	R404L	probably damaging	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Olfr142

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:Olfr142	APN	2	90252609	missense	probably damaging	1.00
IGL01623:Olfr142	APN	2	90252609	missense	probably damaging	1.00
IGL01810:Olfr142	APN	2	90252132	nonsense	probably null
IGL01918:Olfr142	APN	2	90252331	missense	probably damaging	1.00
IGL02619:Olfr142	APN	2	90252505	missense	probably damaging	0.97
IGL02732:Olfr142	APN	2	90252308	missense	probably damaging	1.00
IGL02738:Olfr142	APN	2	90252355	missense	possibly damaging	0.82
IGL02795:Olfr142	APN	2	90252562	missense	probably damaging	1.00
IGL02830:Olfr142	APN	2	90252781	missense	probably damaging	1.00
R0601:Olfr142	UTSW	2	90252934	missense	probably benign	0.05
R2004:Olfr142	UTSW	2	90252692	missense	probably benign	0.04
R2377:Olfr142	UTSW	2	90252911	missense	probably damaging	1.00
R3615:Olfr142	UTSW	2	90252409	missense	possibly damaging	0.94
R3616:Olfr142	UTSW	2	90252409	missense	possibly damaging	0.94
R3777:Olfr142	UTSW	2	90252625	missense	probably damaging	1.00
R4763:Olfr142	UTSW	2	90252463	missense	probably damaging	1.00
R4765:Olfr142	UTSW	2	90252463	missense	probably damaging	1.00
R5421:Olfr142	UTSW	2	90252745	missense	probably benign	0.01
R5426:Olfr142	UTSW	2	90252611	nonsense	probably null
R6063:Olfr142	UTSW	2	90252427	missense	probably benign	0.40
R6717:Olfr142	UTSW	2	90252524	missense	probably benign	0.00
R6931:Olfr142	UTSW	2	90252777	nonsense	probably null
R6936:Olfr142	UTSW	2	90252334	missense	probably benign	0.17
R7013:Olfr142	UTSW	2	90252097	missense	possibly damaging	0.87
R7091:Olfr142	UTSW	2	90252463	missense	probably damaging	1.00
R7247:Olfr142	UTSW	2	90252821	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCCAGGACATTCGTATAGC -3'
(R):5'- GTGGTCCCAATGTGATTGACC -3'

Sequencing Primer
(F):5'- CCAGGACATTCGTATAGCATTTTTC -3'
(R):5'- GGTCCCAATGTGATTGACCACTAC -3'

Posted On

2014-10-01