Mutagenetix > Incidental Mutations

Incidental Mutation 'R2136:Dhx35'

235788

Institutional Source

Beutler Lab

Gene Symbol

Dhx35

Ensembl Gene

ENSMUSG00000027655

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 35

Synonyms

1200009D07Rik, Ddx35

MMRRC Submission

040139-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2136 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158794807-158858214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 158831861 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 404 (R404L)

Ref Sequence

ENSEMBL: ENSMUSP00000105104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029186
AA Change: R404L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: R404L

Domain	Start	End	E-Value	Type
DEXDc	55	248	1.17e-18	SMART
HELICc	299	398	8.76e-18	SMART
HA2	458	549	1.49e-27	SMART
Pfam:OB_NTP_bind	628	660	2.7e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109478
AA Change: R404L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: R404L

Domain	Start	End	E-Value	Type
DEXDc	55	248	1.17e-18	SMART
HELICc	299	398	8.76e-18	SMART
HA2	458	549	1.49e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146797

Predicted Effect

probably benign
Transcript: ENSMUST00000156893

SMART Domains

Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655

Domain	Start	End	E-Value	Type
PDB:3LLM\|B	7	115	1e-10	PDB
Blast:DEXDc	55	119	5e-37	BLAST
SCOP:d1jpna2	63	115	3e-10	SMART
PDB:3KX2\|A	116	204	1e-10	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157070

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	G	6: 41,035,462	F6S	probably benign	Het
2810474O19Rik	T	A	6: 149,328,822	I1122K	probably benign	Het
A930003A15Rik	T	G	16: 19,883,780		noncoding transcript	Het
Abca5	T	C	11: 110,319,832	T174A	probably benign	Het
Abcg3	G	A	5: 104,966,814	S279L	probably benign	Het
Acap3	T	C	4: 155,896,912	L85P	probably damaging	Het
Adgrl3	A	G	5: 81,512,254	K290R	probably damaging	Het
Ankhd1	A	G	18: 36,647,621	T1909A	probably benign	Het
Asap1	T	C	15: 64,110,959	D832G	probably damaging	Het
Atp6v0a2	T	A	5: 124,718,488	L702Q	possibly damaging	Het
Bsn	A	G	9: 108,113,231	V1774A	probably damaging	Het
Cd209e	T	C	8: 3,853,248	E48G	probably benign	Het
Cdadc1	T	C	14: 59,568,044		probably null	Het
Cfap65	C	CA	1: 74,917,273		probably null	Het
Cln3	A	C	7: 126,582,799	S30R	probably benign	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Crb1	A	T	1: 139,337,425	V85E	probably benign	Het
Crocc	G	A	4: 141,032,954	R789W	probably damaging	Het
Cwh43	A	G	5: 73,415,054	I212V	probably benign	Het
Cyp2t4	C	A	7: 27,158,160	F391L	probably benign	Het
Disp1	A	G	1: 183,088,378	L826S	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Ep300	T	A	15: 81,640,447	Y1393N	unknown	Het
Fap	C	T	2: 62,524,207	G446D	possibly damaging	Het
Fat3	A	G	9: 16,377,051	I392T	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Glipr1l1	T	C	10: 112,060,476	V56A	probably damaging	Het
Grsf1	A	G	5: 88,672,658	V7A	probably benign	Het
Hmcn1	G	A	1: 150,633,659	A3646V	probably damaging	Het
Ipo9	A	T	1: 135,394,285	I569N	probably damaging	Het
Irs1	G	T	1: 82,290,042	P151Q	probably damaging	Het
Kalrn	T	C	16: 34,307,724	D491G	possibly damaging	Het
Kctd7	T	C	5: 130,152,366	L210P	probably damaging	Het
Lifr	C	A	15: 7,181,857	D625E	possibly damaging	Het
Lrguk	T	C	6: 34,043,519	V201A	probably benign	Het
Mark1	A	G	1: 184,919,573	V135A	probably damaging	Het
Mical2	T	A	7: 112,271,515	D70E	possibly damaging	Het
Mrc1	T	C	2: 14,270,189	Y434H	probably damaging	Het
Myh10	C	A	11: 68,804,714	Q1556K	probably damaging	Het
Nav1	G	A	1: 135,454,436	T1400I	probably null	Het
Olfr1173	T	C	2: 88,274,240	K270E	probably damaging	Het
Olfr1178	T	A	2: 88,391,319	I24N	probably benign	Het
Olfr1289	T	C	2: 111,483,616	V62A	probably damaging	Het
Olfr13	A	G	6: 43,174,501	K172E	probably benign	Het
Olfr142	A	C	2: 90,252,253	V245G	probably damaging	Het
Olfr339	A	G	2: 36,421,938	D180G	probably damaging	Het
Olfr513	G	A	7: 108,755,223	M122I	possibly damaging	Het
Osmr	T	A	15: 6,852,462	Q67L	probably damaging	Het
Pan2	T	G	10: 128,313,637	V522G	possibly damaging	Het
Pard3	T	G	8: 127,376,885		probably null	Het
Pcdhgc5	G	T	18: 37,820,113	A147S	possibly damaging	Het
Pcsk9	T	C	4: 106,446,770	I506V	probably benign	Het
Polr3d	GCCCCC	GCCCC	14: 70,443,047		probably null	Het
Prdm4	G	A	10: 85,893,351	R731*	probably null	Het
Prdx6b	T	A	2: 80,293,163	D105E	probably damaging	Het
Rab42	A	G	4: 132,302,479	L144P	probably damaging	Het
Ralbp1	T	A	17: 65,864,666	K104M	probably damaging	Het
Rrp12	A	G	19: 41,892,599	V131A	probably damaging	Het
Sbno1	C	T	5: 124,387,534		probably null	Het
Sbno2	A	T	10: 80,062,693	I645N	probably damaging	Het
Scfd2	T	C	5: 74,206,367	K624R	probably benign	Het
Sgk2	C	A	2: 162,999,179		probably null	Het
Sirt4	A	G	5: 115,479,701	S299P	probably benign	Het
Slit2	C	T	5: 48,304,225	A1521V	probably benign	Het
Socs7	T	G	11: 97,373,107	V275G	possibly damaging	Het
Spink11	G	A	18: 44,190,487	P102S	probably benign	Het
Tacc3	A	G	5: 33,671,404	N534D	probably damaging	Het
Tas2r115	T	C	6: 132,737,346	Y214C	probably damaging	Het
Tcaf1	A	T	6: 42,673,520	M875K	probably benign	Het
Ttc22	T	A	4: 106,622,672	L41Q	possibly damaging	Het
Ttc37	T	C	13: 76,173,354	S1322P	possibly damaging	Het
Vasn	T	A	16: 4,649,795	C535*	probably null	Het
Vcan	T	A	13: 89,689,737	I2563F	probably damaging	Het
Vmn2r63	T	G	7: 42,926,873	Q505H	probably damaging	Het
Vmn2r65	T	G	7: 84,943,573	Q475H	probably damaging	Het
Zbtb43	T	C	2: 33,454,520	Y231C	probably damaging	Het
Zfp292	A	G	4: 34,810,266	V931A	probably benign	Het

Other mutations in Dhx35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Dhx35	APN	2	158827916	missense	probably damaging	1.00
IGL01942:Dhx35	APN	2	158831864	missense	probably damaging	1.00
IGL02899:Dhx35	APN	2	158801450	missense	probably damaging	1.00
IGL02927:Dhx35	APN	2	158820416	missense	probably damaging	1.00
IGL03224:Dhx35	APN	2	158857132	utr 3 prime	probably benign
R0112:Dhx35	UTSW	2	158840620	missense	probably damaging	0.99
R0200:Dhx35	UTSW	2	158829623	missense	probably benign
R0609:Dhx35	UTSW	2	158817415	missense	possibly damaging	0.62
R0714:Dhx35	UTSW	2	158844183	missense	probably benign
R0884:Dhx35	UTSW	2	158831711	missense	probably damaging	0.97
R1775:Dhx35	UTSW	2	158806437	missense	probably damaging	1.00
R1912:Dhx35	UTSW	2	158842307	missense	probably damaging	0.96
R4094:Dhx35	UTSW	2	158842356	missense	probably damaging	1.00
R4364:Dhx35	UTSW	2	158842352	nonsense	probably null
R4421:Dhx35	UTSW	2	158806401	missense	probably damaging	1.00
R4565:Dhx35	UTSW	2	158849535	missense	probably benign	0.01
R5517:Dhx35	UTSW	2	158834912	missense	probably damaging	1.00
R5732:Dhx35	UTSW	2	158831785	missense	probably damaging	0.99
R5979:Dhx35	UTSW	2	158842869	missense	probably benign	0.29
R6054:Dhx35	UTSW	2	158818299	missense	probably benign	0.00
R6405:Dhx35	UTSW	2	158794919	missense	probably damaging	1.00
R6452:Dhx35	UTSW	2	158831687	missense	probably damaging	1.00
R6519:Dhx35	UTSW	2	158831710	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGTGGCAGAGACTTCCATCAC -3'
(R):5'- CCCAACATTAGGTTAGAATGGAGG -3'

Sequencing Primer
(F):5'- CACAATCAGTGGCATTGTGTATG -3'
(R):5'- TGGTTCACTGAGCCAGCTG -3'

Posted On

2014-10-01