Incidental Mutation 'R2136:Atp6v0a2'
ID 235805
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s
MMRRC Submission 040139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock # R2136 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124628576-124724455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124718488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 702 (L702Q)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]
AlphaFold P15920
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037865
AA Change: L702Q

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: L702Q

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197087
Predicted Effect silent
Transcript: ENSMUST00000197161
SMART Domains Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199971
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr13 A G 6: 43,174,501 K172E probably benign Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124721777 missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124646028 missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124636105 missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124646014 missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124721785 missense probably benign
IGL02650:Atp6v0a2 APN 5 124712362 splice site probably benign
IGL02687:Atp6v0a2 APN 5 124714142 missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124629202 missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124712781 missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124714107 splice site probably benign
IGL03198:Atp6v0a2 APN 5 124712361 critical splice donor site probably null
alkaline UTSW 5 124719866 missense probably damaging 1.00
basic UTSW 5 124712328 nonsense probably null
electronegative UTSW 5 124646698 missense probably damaging 1.00
energizer UTSW 5 124719986 missense probably damaging 0.98
Everready UTSW 5 124641505 missense probably damaging 0.99
Lithium UTSW 5 124714145 missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124713184 missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124717982 missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124646698 missense probably damaging 1.00
R2921:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124627144 unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124712796 missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124646734 missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124646727 missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124713185 missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124713177 missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124646709 missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124645969 nonsense probably null
R5830:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124716327 missense probably benign
R5903:Atp6v0a2 UTSW 5 124712279 missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124629203 missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124713130 missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124641514 missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124712161 splice site probably null
R6994:Atp6v0a2 UTSW 5 124714145 missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124645983 missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124719866 missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124646736 missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124712328 nonsense probably null
R7714:Atp6v0a2 UTSW 5 124637595 missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124714198 missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124716496 missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124645031 missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R7977:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R7987:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124712773 missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124719088 missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124716470 missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124646649 missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124719997 missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124719074 missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124712248 missense probably damaging 0.98
R9360:Atp6v0a2 UTSW 5 124629194 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCCCATTGCTCTGAGACAGTC -3'
(R):5'- AACTTGTGATGTGGCCACTTG -3'

Sequencing Primer
(F):5'- CCATTGCTCTGAGACAGTCTAAAGG -3'
(R):5'- ACTTGGCCTGCATGAAGG -3'
Posted On 2014-10-01