Incidental Mutation 'R2136:Olfr13'
ID235810
Institutional Source Beutler Lab
Gene Symbol Olfr13
Ensembl Gene ENSMUSG00000043605
Gene Nameolfactory receptor 13
SynonymsMOR261-6, GA_x6K02T2P3E9-4384160-4383228
MMRRC Submission 040139-MU
Accession Numbers

Genbank: NM_146652; MGI: 104812

Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2136 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location43172140-43177460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43174501 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 172 (K172E)
Ref Sequence ENSEMBL: ENSMUSP00000149893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059512] [ENSMUST00000205175] [ENSMUST00000216179]
Predicted Effect probably benign
Transcript: ENSMUST00000059512
AA Change: K172E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053813
Gene: ENSMUSG00000043605
AA Change: K172E

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 34 218 1.3e-6 PFAM
Pfam:7tm_1 40 289 6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205175
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216179
AA Change: K172E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,035,462 F6S probably benign Het
2810474O19Rik T A 6: 149,328,822 I1122K probably benign Het
A930003A15Rik T G 16: 19,883,780 noncoding transcript Het
Abca5 T C 11: 110,319,832 T174A probably benign Het
Abcg3 G A 5: 104,966,814 S279L probably benign Het
Acap3 T C 4: 155,896,912 L85P probably damaging Het
Adgrl3 A G 5: 81,512,254 K290R probably damaging Het
Ankhd1 A G 18: 36,647,621 T1909A probably benign Het
Asap1 T C 15: 64,110,959 D832G probably damaging Het
Atp6v0a2 T A 5: 124,718,488 L702Q possibly damaging Het
Bsn A G 9: 108,113,231 V1774A probably damaging Het
Cd209e T C 8: 3,853,248 E48G probably benign Het
Cdadc1 T C 14: 59,568,044 probably null Het
Cfap65 C CA 1: 74,917,273 probably null Het
Cln3 A C 7: 126,582,799 S30R probably benign Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Crb1 A T 1: 139,337,425 V85E probably benign Het
Crocc G A 4: 141,032,954 R789W probably damaging Het
Cwh43 A G 5: 73,415,054 I212V probably benign Het
Cyp2t4 C A 7: 27,158,160 F391L probably benign Het
Dhx35 G T 2: 158,831,861 R404L probably damaging Het
Disp1 A G 1: 183,088,378 L826S probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Ep300 T A 15: 81,640,447 Y1393N unknown Het
Fap C T 2: 62,524,207 G446D possibly damaging Het
Fat3 A G 9: 16,377,051 I392T probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glipr1l1 T C 10: 112,060,476 V56A probably damaging Het
Grsf1 A G 5: 88,672,658 V7A probably benign Het
Hmcn1 G A 1: 150,633,659 A3646V probably damaging Het
Ipo9 A T 1: 135,394,285 I569N probably damaging Het
Irs1 G T 1: 82,290,042 P151Q probably damaging Het
Kalrn T C 16: 34,307,724 D491G possibly damaging Het
Kctd7 T C 5: 130,152,366 L210P probably damaging Het
Lifr C A 15: 7,181,857 D625E possibly damaging Het
Lrguk T C 6: 34,043,519 V201A probably benign Het
Mark1 A G 1: 184,919,573 V135A probably damaging Het
Mical2 T A 7: 112,271,515 D70E possibly damaging Het
Mrc1 T C 2: 14,270,189 Y434H probably damaging Het
Myh10 C A 11: 68,804,714 Q1556K probably damaging Het
Nav1 G A 1: 135,454,436 T1400I probably null Het
Olfr1173 T C 2: 88,274,240 K270E probably damaging Het
Olfr1178 T A 2: 88,391,319 I24N probably benign Het
Olfr1289 T C 2: 111,483,616 V62A probably damaging Het
Olfr142 A C 2: 90,252,253 V245G probably damaging Het
Olfr339 A G 2: 36,421,938 D180G probably damaging Het
Olfr513 G A 7: 108,755,223 M122I possibly damaging Het
Osmr T A 15: 6,852,462 Q67L probably damaging Het
Pan2 T G 10: 128,313,637 V522G possibly damaging Het
Pard3 T G 8: 127,376,885 probably null Het
Pcdhgc5 G T 18: 37,820,113 A147S possibly damaging Het
Pcsk9 T C 4: 106,446,770 I506V probably benign Het
Polr3d GCCCCC GCCCC 14: 70,443,047 probably null Het
Prdm4 G A 10: 85,893,351 R731* probably null Het
Prdx6b T A 2: 80,293,163 D105E probably damaging Het
Rab42 A G 4: 132,302,479 L144P probably damaging Het
Ralbp1 T A 17: 65,864,666 K104M probably damaging Het
Rrp12 A G 19: 41,892,599 V131A probably damaging Het
Sbno1 C T 5: 124,387,534 probably null Het
Sbno2 A T 10: 80,062,693 I645N probably damaging Het
Scfd2 T C 5: 74,206,367 K624R probably benign Het
Sgk2 C A 2: 162,999,179 probably null Het
Sirt4 A G 5: 115,479,701 S299P probably benign Het
Slit2 C T 5: 48,304,225 A1521V probably benign Het
Socs7 T G 11: 97,373,107 V275G possibly damaging Het
Spink11 G A 18: 44,190,487 P102S probably benign Het
Tacc3 A G 5: 33,671,404 N534D probably damaging Het
Tas2r115 T C 6: 132,737,346 Y214C probably damaging Het
Tcaf1 A T 6: 42,673,520 M875K probably benign Het
Ttc22 T A 4: 106,622,672 L41Q possibly damaging Het
Ttc37 T C 13: 76,173,354 S1322P possibly damaging Het
Vasn T A 16: 4,649,795 C535* probably null Het
Vcan T A 13: 89,689,737 I2563F probably damaging Het
Vmn2r63 T G 7: 42,926,873 Q505H probably damaging Het
Vmn2r65 T G 7: 84,943,573 Q475H probably damaging Het
Zbtb43 T C 2: 33,454,520 Y231C probably damaging Het
Zfp292 A G 4: 34,810,266 V931A probably benign Het
Other mutations in Olfr13
AlleleSourceChrCoordTypePredicted EffectPPH Score
N/A - 293:Olfr13 UTSW 6 43174559 missense probably benign 0.45
R0279:Olfr13 UTSW 6 43174758 missense probably benign 0.03
R0594:Olfr13 UTSW 6 43174607 missense possibly damaging 0.64
R0669:Olfr13 UTSW 6 43174004 missense probably benign 0.36
R1339:Olfr13 UTSW 6 43174610 missense probably benign 0.39
R1371:Olfr13 UTSW 6 43174300 missense probably benign 0.01
R1669:Olfr13 UTSW 6 43174821 missense probably damaging 1.00
R1832:Olfr13 UTSW 6 43174900 missense probably benign
R4358:Olfr13 UTSW 6 43174226 missense probably damaging 0.97
R4755:Olfr13 UTSW 6 43174043 missense probably benign 0.00
R4933:Olfr13 UTSW 6 43174321 missense probably benign 0.22
R5504:Olfr13 UTSW 6 43174638 nonsense probably null
R5677:Olfr13 UTSW 6 43174331 missense probably benign 0.35
R5917:Olfr13 UTSW 6 43174712 missense probably damaging 1.00
R6287:Olfr13 UTSW 6 43174435 missense probably benign 0.00
R6480:Olfr13 UTSW 6 43174066 missense probably benign 0.05
R7020:Olfr13 UTSW 6 43174162 missense possibly damaging 0.91
R7240:Olfr13 UTSW 6 43174501 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGGTTGTATGACACAGAC -3'
(R):5'- CTGGATCTTCAGGATAGCACC -3'

Sequencing Primer
(F):5'- ACAGAATGCCTTCTCCTAGTGGTG -3'
(R):5'- GATCTTCAGGATAGCACCAAGGATAC -3'
Posted On2014-10-01